ID: 1095453995

View in Genome Browser
Species Human (GRCh38)
Location 12:42363213-42363235
Sequence ACAGTGATGATACTGGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095453995 Original CRISPR ACAGTGATGATACTGGTGTC AGG (reversed) Intronic
905856437 1:41317648-41317670 TAAGTGATGCTACTGCTGTCGGG + Intergenic
906490377 1:46263672-46263694 ACAGTGATGAAGCAGATGTCAGG - Intronic
910135719 1:83966784-83966806 ACAGCAGTGATAATGGTGTCAGG - Intronic
910298981 1:85683978-85684000 ACAGTGATGATTCTGCTTCCAGG - Intronic
911042562 1:93602414-93602436 GCAGTGATGATGCAGGTCTCAGG - Intronic
916005623 1:160657197-160657219 ACAGTTAAGATTCTGGTGCCTGG + Intergenic
916403586 1:164474990-164475012 ACAGTGGTGATAGTGGTGGTAGG + Intergenic
919447177 1:197721401-197721423 ATACTGATGCTACTGGTCTCAGG + Intronic
920205470 1:204287949-204287971 ATAGTAATGATACTGGAATCTGG + Intronic
920597758 1:207290395-207290417 ACAGTGCTGATCCAGGTGTCAGG - Intergenic
921254919 1:213330422-213330444 ACAGTGCTGAGACAGGTGACTGG + Intergenic
921750046 1:218781884-218781906 TCAGAGATAATACTGGTGACGGG - Intergenic
922188043 1:223293628-223293650 ACAAGGAGGATGCTGGTGTCTGG + Intronic
1062871215 10:906522-906544 ACAGCGTTGATCCTGGTGACAGG + Intronic
1068817301 10:61332042-61332064 ACAGAGATGTTAGAGGTGTCAGG + Intergenic
1070031101 10:72678165-72678187 ACAGTGGTCATACTGGTGGTGGG + Intergenic
1078560044 11:12363501-12363523 CCAGTGATTGTACTGGTGTGTGG - Intergenic
1079170987 11:18095510-18095532 ACAGTGGTTATACTGAAGTCAGG + Intronic
1080844157 11:36011912-36011934 ACAGTCATGATGCTGGTGACAGG - Intronic
1081508088 11:43739055-43739077 ACATAGATAAAACTGGTGTCAGG + Intronic
1086981314 11:93200683-93200705 ACAGAGATGAGACTGGGCTCAGG + Intergenic
1089280238 11:117368975-117368997 ACAGTGGTGATACTGTCATCAGG - Intronic
1092639864 12:10493970-10493992 GGAGTGATCCTACTGGTGTCAGG + Intergenic
1095453995 12:42363213-42363235 ACAGTGATGATACTGGTGTCAGG - Intronic
1098670575 12:73225129-73225151 ATAATGATGATAATGGTGTGTGG - Intergenic
1099611311 12:84875361-84875383 AAAATGCTGACACTGGTGTCTGG - Intronic
1101858431 12:108463230-108463252 ACAGTGAGGACACTGGAGCCAGG + Intergenic
1102504825 12:113377384-113377406 ACAGAGATGATGCTGGGGTGGGG - Intronic
1104584963 12:130040964-130040986 CCAGTGATGATAATGGAGGCTGG - Intergenic
1106821812 13:33473193-33473215 AGAGAGATGAATCTGGTGTCAGG + Intergenic
1109482642 13:62975747-62975769 ACAGTGAAGAAACTGGTTACAGG - Intergenic
1114339012 14:21723701-21723723 AGAGAGAAGATACCGGTGTCGGG + Intergenic
1116114056 14:40625464-40625486 ACAGTGATGATAATAGTGGCAGG - Intergenic
1117163034 14:53007680-53007702 AAAGTGATGATAATGGTGATTGG + Intergenic
1118826009 14:69382081-69382103 ACAGTGAGGACTCTGGAGTCAGG - Intronic
1119811330 14:77522482-77522504 ACAGATATGTTACTGTTGTCTGG - Intronic
1120390447 14:83900788-83900810 ACAGTTATGATTCTGAAGTCAGG - Intergenic
1120623441 14:86793698-86793720 GCAGTGATGATACCTCTGTCAGG - Intergenic
1126029808 15:44485419-44485441 ACAGTGATGGGAATGGTTTCAGG + Intronic
1128784908 15:70387671-70387693 CCAGTGAGGAAACTTGTGTCTGG + Intergenic
1131454493 15:92572462-92572484 ACAATGAGGATACTGGAGTCCGG + Intergenic
1202983573 15_KI270727v1_random:389920-389942 ACAGAGAGGTTACTGGAGTCTGG + Intergenic
1136064377 16:27748884-27748906 ACAGTGTTGTTCCTGGTTTCTGG - Intronic
1136595878 16:31249507-31249529 ACAGTAATGATACTTATATCAGG + Intergenic
1136713559 16:32259351-32259373 TCAGTGATGGTGCTGGTGTGTGG - Intergenic
1136754352 16:32670080-32670102 TCAGTGATGGTGCTGGTGTGTGG + Intergenic
1136813761 16:33200285-33200307 TCAGTGATGGTGCTGGTGTGTGG - Intronic
1136820237 16:33310365-33310387 TCAGTGATGGTGCTGGTGTGTGG - Intergenic
1136826800 16:33366904-33366926 TCAGTGATGGTGCTGGTGTGTGG - Intergenic
1136831866 16:33465675-33465697 TCAGTGATGGTGCTGGTGTGTGG - Intergenic
1137674908 16:50299414-50299436 CCAGTGAAGATCCTGGAGTCAGG + Intronic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1202992337 16_KI270728v1_random:23259-23281 TCAGTGATGGTGCTGGTGTGTGG - Intergenic
1203056499 16_KI270728v1_random:930411-930433 TCAGTGATGGTGCTGGTGTGTGG + Intergenic
1142869307 17:2809875-2809897 ACAGAGACGACGCTGGTGTCTGG + Intronic
1143102225 17:4510699-4510721 ACAGTCACGATTTTGGTGTCGGG - Intronic
1144438599 17:15262187-15262209 AGGGTGATGGTGCTGGTGTCTGG - Intronic
1146026616 17:29327117-29327139 ATACTGATGATACTGGTCTGTGG - Intergenic
1153429816 18:5004079-5004101 GCAGTGAAGATATTGGGGTCTGG - Intergenic
1157040463 18:44033156-44033178 ACACAGAAGATACTGGTTTCTGG + Intergenic
1157405784 18:47421620-47421642 ACAGTGATGGTACATTTGTCAGG - Intergenic
1157723159 18:49941529-49941551 ATACTGATGATATTGTTGTCAGG + Intronic
1163219304 19:15903013-15903035 ACAGTGATGACCGTGGTGTACGG - Intergenic
1164732534 19:30517215-30517237 CCAGTGATGATTGTGGGGTCAGG - Intronic
1168085439 19:54042351-54042373 ACAAAGATGGTTCTGGTGTCTGG + Exonic
928274848 2:29891193-29891215 ACTGTGATGTTACAGGTGTATGG - Intronic
929232192 2:39571334-39571356 AGAATGATCATACTGGTGGCTGG - Intergenic
935864339 2:107369186-107369208 ACAGTTAGGATAATGGTATCCGG - Intergenic
936147614 2:109991334-109991356 ACAGTGATGTTTTTGGTCTCTGG + Intergenic
936197078 2:110380107-110380129 ACAGTGATGTTTTTGGTCTCTGG - Intergenic
937255022 2:120549179-120549201 ACAGTCATCATTCTGGTGTGGGG + Intergenic
939224772 2:139351052-139351074 CCAGTGATGATGCTGCTGCCTGG + Intergenic
946592931 2:221271458-221271480 GCAGTCATGATTCAGGTGTCAGG - Intergenic
1170357168 20:15505541-15505563 ACAGAGATGATGCTGGGGCCGGG - Intronic
1172105516 20:32515028-32515050 ACAGTCATGACACTGCAGTCAGG - Intronic
1173417168 20:42866990-42867012 ACAGTGATGACATTAGTATCAGG - Intronic
1173670065 20:44792819-44792841 AAAGTGCTGAAACTGGTTTCTGG - Intronic
1203293123 22_KI270736v1_random:14772-14794 ACAGTGATGATGGTAGTGGCAGG + Intergenic
951450623 3:22833915-22833937 ACATTGAAAATACTGGGGTCTGG - Intergenic
951772570 3:26275031-26275053 AGAGTGATGATTCTGGTATCTGG + Intergenic
951837576 3:27000226-27000248 ACAGTGATGACACTGGCATATGG - Intergenic
953365972 3:42345449-42345471 ACAGTGATGCTACTGTTGCTTGG + Intergenic
955118513 3:56031220-56031242 ACAGGGATGAGCCTGTTGTCTGG - Intronic
960356656 3:116662221-116662243 CCTGTGTTGATTCTGGTGTCAGG - Intronic
961383620 3:126511451-126511473 ATAGTGAGGACAGTGGTGTCAGG - Intronic
965780845 3:172284509-172284531 ACAGAAATGAGGCTGGTGTCAGG + Intronic
966159524 3:176953310-176953332 ATACTGATGATGTTGGTGTCAGG - Intergenic
967455440 3:189680895-189680917 ACAGAGATGAGCCTGGAGTCTGG + Intronic
968231348 3:197006574-197006596 ACGGTGAAGATGTTGGTGTCGGG + Exonic
970639916 4:18052326-18052348 ACAGTGAGGTTAATGGTGACTGG + Intergenic
971164936 4:24173098-24173120 ACAGGCATGTTACTGGTGACAGG + Intergenic
972545561 4:40076906-40076928 ACATTGATGATACTGGTTTTTGG + Intronic
975704783 4:77100998-77101020 ACAGTGGTCATACTTGTCTCAGG - Intergenic
978683926 4:111415908-111415930 ACAATGTTGCTACTGGTGGCTGG + Intergenic
984022356 4:174501202-174501224 ATAGTCATTATACTGGTATCTGG - Intronic
984499727 4:180544539-180544561 ACAGTGATGATGCTGATGGCTGG - Intergenic
984688996 4:182703935-182703957 ACAGTGATTACAGTGGTGTCTGG - Intronic
988503022 5:31799215-31799237 CCTCTGATGATGCTGGTGTCTGG + Exonic
988708038 5:33744628-33744650 ACAGTAATGATACTGGGGAAAGG + Intronic
992666996 5:79020014-79020036 ACAGTGATGCTGCTGGTCTGTGG + Intronic
992812515 5:80403700-80403722 TAAGTGATGATACGTGTGTCTGG + Intergenic
993732817 5:91443083-91443105 CCAGAGATGATACTGATGTATGG - Intergenic
994862594 5:105217482-105217504 ACAGTCATGACACTGGTGACTGG - Intergenic
995260827 5:110102679-110102701 ACTGTCATGATACAGGTATCAGG + Intergenic
995335541 5:110994891-110994913 ACAGTGATGATCTTGGTGGTGGG + Intergenic
996278597 5:121698955-121698977 ACAGAGATAATACTTGTGTAAGG - Intergenic
1001123507 5:168998785-168998807 ACAGTGATGCTGCTGGTCTGGGG - Intronic
1003073465 6:2962474-2962496 ACAGAGAGGAAACTGGTATCAGG - Intronic
1012524221 6:100157859-100157881 ACAGTGATGTTTCTGGAGTCGGG - Intergenic
1016536381 6:145111255-145111277 ACAGGAGTGATACTGGTTTCAGG - Intergenic
1016725134 6:147355556-147355578 ATAGTGATGATATGGCTGTCTGG + Intronic
1017110714 6:150929533-150929555 GCTGTGATGATACTGTTTTCAGG + Intronic
1020778570 7:12489572-12489594 ATAGTCATGATACTGGTCTAGGG + Intergenic
1022597796 7:31729271-31729293 ACAGTGATGAGCCTTGTGTGAGG + Intergenic
1026918025 7:74134297-74134319 ACAGTGATGAAACTGACCTCTGG + Intergenic
1027555969 7:79665185-79665207 ACAGTAATGGCATTGGTGTCTGG - Intergenic
1027814888 7:82955741-82955763 CAAGTGATGATACTGATGTAGGG + Exonic
1029637328 7:101793792-101793814 TCAGTGATGACTCTGGTGCCTGG + Intergenic
1031769066 7:125820250-125820272 ACAGAGATTATACTTGTTTCAGG + Intergenic
1033589017 7:142795518-142795540 ACAGTGATGGTAATGGTGGGGGG - Intergenic
1034017329 7:147601185-147601207 CCAGTGAAAATACTGATGTCTGG - Intronic
1036467261 8:9012043-9012065 ACACTAATGATACTGATGCCTGG + Intronic
1036686644 8:10916060-10916082 ACAGTGCTGATCTTGGGGTCAGG - Intronic
1039374962 8:37024007-37024029 CCACTGATGATACTGGTGTTCGG + Intergenic
1039427831 8:37501304-37501326 TCAGTGCTGAGTCTGGTGTCTGG - Intergenic
1041782683 8:61595253-61595275 ACTGTGAAGATCCTGGTCTCTGG + Intronic
1042979873 8:74514546-74514568 ACAGTCATGGCACTGGTGTCTGG - Intergenic
1042992452 8:74656101-74656123 ACAATGAAGATACAGGTATCAGG - Intronic
1046912405 8:119643574-119643596 GCAGAGATTATTCTGGTGTCGGG - Intronic
1047379228 8:124342134-124342156 ACAGTGATGATACAGTTGACAGG - Intronic
1053274966 9:36776367-36776389 ACAGTGGGGATACTGTTGTGAGG - Intergenic
1055101322 9:72468451-72468473 ACAGAGATGATAGGGGTGTGGGG + Intergenic
1057677503 9:97147294-97147316 ACAATGATGATACAGGTATTGGG + Intergenic
1057827745 9:98383690-98383712 ACAGTGAAGTTACTGGTAACAGG + Intronic
1058335017 9:103816273-103816295 TTAGTAATGATTCTGGTGTCAGG + Intergenic
1059184312 9:112253440-112253462 ATTGTGAGGATATTGGTGTCAGG - Intronic
1059716241 9:116915947-116915969 ACTGTGAGGATACTTGTGTCAGG + Intronic
1060013909 9:120069709-120069731 AGAGTGTAGATTCTGGTGTCAGG - Intergenic
1060280086 9:122209802-122209824 GCAGAGATGAAACTGGTTTCAGG - Intronic
1189016524 X:37290748-37290770 ACATTGGTGATGCTGGAGTCTGG - Intergenic
1189016554 X:37290913-37290935 ACAGTGGTAATGCTGGTGTCTGG - Intergenic
1189183728 X:39032086-39032108 CCACTGATGATACTGCTGGCTGG + Intergenic
1197457202 X:126691971-126691993 ACAGTGAAGATTTTGATGTCAGG - Intergenic
1197866198 X:131020569-131020591 ACAGAGATGATCCTGTAGTCTGG + Intergenic