ID: 1095460111

View in Genome Browser
Species Human (GRCh38)
Location 12:42434466-42434488
Sequence ACCAGGCAACTATAAACTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 146}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095460111_1095460123 25 Left 1095460111 12:42434466-42434488 CCCTCAGTTTATAGTTGCCTGGT 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1095460123 12:42434514-42434536 GTGAATTGGTTTCTGTATTGGGG 0: 1
1: 0
2: 2
3: 12
4: 199
1095460111_1095460117 -2 Left 1095460111 12:42434466-42434488 CCCTCAGTTTATAGTTGCCTGGT 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1095460117 12:42434487-42434509 GTCAGAAGTTTTGGAGGCCTGGG 0: 1
1: 2
2: 13
3: 85
4: 1855
1095460111_1095460124 26 Left 1095460111 12:42434466-42434488 CCCTCAGTTTATAGTTGCCTGGT 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1095460124 12:42434515-42434537 TGAATTGGTTTCTGTATTGGGGG 0: 1
1: 0
2: 0
3: 20
4: 216
1095460111_1095460118 11 Left 1095460111 12:42434466-42434488 CCCTCAGTTTATAGTTGCCTGGT 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1095460118 12:42434500-42434522 GAGGCCTGGGACCTGTGAATTGG 0: 1
1: 0
2: 2
3: 24
4: 216
1095460111_1095460121 23 Left 1095460111 12:42434466-42434488 CCCTCAGTTTATAGTTGCCTGGT 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1095460121 12:42434512-42434534 CTGTGAATTGGTTTCTGTATTGG 0: 1
1: 0
2: 0
3: 25
4: 238
1095460111_1095460116 -3 Left 1095460111 12:42434466-42434488 CCCTCAGTTTATAGTTGCCTGGT 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1095460116 12:42434486-42434508 GGTCAGAAGTTTTGGAGGCCTGG 0: 1
1: 17
2: 52
3: 110
4: 358
1095460111_1095460114 -8 Left 1095460111 12:42434466-42434488 CCCTCAGTTTATAGTTGCCTGGT 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1095460114 12:42434481-42434503 TGCCTGGTCAGAAGTTTTGGAGG 0: 1
1: 1
2: 1
3: 42
4: 184
1095460111_1095460122 24 Left 1095460111 12:42434466-42434488 CCCTCAGTTTATAGTTGCCTGGT 0: 1
1: 0
2: 0
3: 14
4: 146
Right 1095460122 12:42434513-42434535 TGTGAATTGGTTTCTGTATTGGG 0: 1
1: 0
2: 0
3: 48
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095460111 Original CRISPR ACCAGGCAACTATAAACTGA GGG (reversed) Intronic
901245058 1:7723754-7723776 ACCAGGCAAACCTAAATTGAGGG + Intronic
907203964 1:52752612-52752634 ACCAATGAACTATAAACTGTGGG - Intronic
909060614 1:70875023-70875045 ACCAGGCAACTATTAGCCTAGGG + Intronic
912282060 1:108326429-108326451 CCCAGGCAAACAAAAACTGAGGG - Intergenic
915939802 1:160111981-160112003 AACAGGTCACTATAACCTGAGGG + Intergenic
919193499 1:194253500-194253522 ACCAACCAGCTATAAATTGAAGG - Intergenic
921211329 1:212901633-212901655 CCCAGACAAATAAAAACTGAGGG + Intergenic
921746442 1:218745323-218745345 CCCAGACAAATAAAAACTGAGGG + Intergenic
922051504 1:221994900-221994922 ACAAAGAAACTATAAAATGATGG + Intergenic
924821213 1:247492236-247492258 AGCAGGCAACTTCAAACAGAAGG - Intergenic
1065473969 10:26114030-26114052 ACCAGGCAGATAAGAACTGATGG - Intronic
1069822439 10:71236038-71236060 ACTCGTCAACTGTAAACTGAAGG + Intronic
1070587485 10:77777519-77777541 ATCAGGCAAATCTAAAATGAAGG - Intergenic
1071245434 10:83756093-83756115 TCCAGGCAAGTAAAAACTAAGGG + Intergenic
1071828952 10:89353102-89353124 ACCAGGCAACCATCAGGTGATGG + Intronic
1072289709 10:93952714-93952736 ACCAATCCTCTATAAACTGAGGG + Intronic
1072312994 10:94174698-94174720 ATCAGGCAACTCTAAATTGAAGG + Intronic
1075193568 10:120334069-120334091 ACCAAGCAAATATTCACTGAGGG - Intergenic
1077452535 11:2657808-2657830 ACCAGACAAATCCAAACTGAGGG - Intronic
1077572380 11:3351093-3351115 AACAGGCAAGTAAAAACAGAGGG + Intronic
1079615110 11:22482427-22482449 CCCAGGCACCTATAAATTAAGGG - Intergenic
1080115198 11:28614402-28614424 ATCAGCCAACTATCAACTCAGGG - Intergenic
1086012185 11:82119103-82119125 ACCAGACAACTAGAAACAGCAGG - Intergenic
1086020451 11:82222747-82222769 AATAGGCAACAATAAACTAATGG - Intergenic
1086349675 11:85932936-85932958 ATCAGGCAACCATCAAGTGATGG - Intergenic
1090609791 11:128460577-128460599 ACTGGGCAACTATAGAGTGAGGG + Exonic
1090781874 11:130014119-130014141 ACCAGGCAAACACTAACTGAAGG + Intergenic
1093123835 12:15305144-15305166 CCCAGGCAAATAGAAGCTGAGGG - Intronic
1093628511 12:21380909-21380931 ATCAGGCGACTATCAGCTGATGG + Intronic
1095118780 12:38387761-38387783 ACCAGGCAAATAAAAACAGTGGG - Intergenic
1095460111 12:42434466-42434488 ACCAGGCAACTATAAACTGAGGG - Intronic
1095763332 12:45866597-45866619 ACCTGGCTACTCAAAACTGAGGG + Intronic
1095848485 12:46773983-46774005 AGAAGACAACTATAAACAGAAGG - Intronic
1099428363 12:82551797-82551819 TCCAGGCAAATAAAAGCTGAAGG - Intergenic
1103882839 12:124179657-124179679 AACAGAGAAATATAAACTGAAGG + Intronic
1105062263 12:133163329-133163351 CCCAGGCAAATAAAAACTTAGGG + Intronic
1107939560 13:45371900-45371922 CACAGGCCACTATAAAATGATGG - Intergenic
1108582853 13:51841332-51841354 ACCAGGCAAGTGTAAAGAGATGG - Intergenic
1109310899 13:60692184-60692206 CCTAGGAAACTAGAAACTGATGG - Intergenic
1109677459 13:65696970-65696992 ATCAGTGAACTTTAAACTGAGGG + Intergenic
1110136345 13:72071939-72071961 AGGAGGCATCAATAAACTGAAGG + Intergenic
1110149990 13:72239699-72239721 ACCATGCCAGTATATACTGAAGG - Intergenic
1110398122 13:75056579-75056601 AAAAGGCAACTATAAACGTATGG + Intergenic
1113172614 13:107522538-107522560 ACCAGACAAATATGAACTGAAGG - Intronic
1113860054 13:113476138-113476160 ACCAGGAAACTAGAAACAGCCGG - Intronic
1115288977 14:31749405-31749427 CCCAGGCAAGCAAAAACTGAGGG - Intronic
1121785531 14:96657358-96657380 ACCAACCAACTATAAATTGAGGG - Intergenic
1122721409 14:103724504-103724526 ACCTGGCGAGCATAAACTGAGGG - Intronic
1124080126 15:26486042-26486064 ATCAGACAAATCTAAACTGAAGG + Intergenic
1125872466 15:43114650-43114672 ACAAAGCTACTGTAAACTGAAGG - Intronic
1127359627 15:58233604-58233626 ATCAGGCAATTATTAACTCAAGG + Intronic
1129012751 15:72437757-72437779 TCCAGGTAAATAAAAACTGAGGG - Intergenic
1131444544 15:92486416-92486438 ATGAAGCAACTATAAAATGATGG + Intronic
1137692159 16:50436279-50436301 CCCAGGCAATTACAAACTCAAGG - Intergenic
1138041897 16:53680393-53680415 ATCAGGCAAATCCAAACTGAGGG + Intronic
1138852524 16:60646263-60646285 ACCATGTAACTATAAAATGATGG + Intergenic
1140185320 16:72764377-72764399 ACCAGTAAACTAAAAACAGAAGG + Intergenic
1144448333 17:15352743-15352765 AAAAGGCAACTGTAAACTCAAGG - Intergenic
1148997966 17:51728538-51728560 ATCAGACAAACATAAACTGAGGG - Intronic
1151652824 17:75480747-75480769 ACCAGGCAACTGTACACAGCTGG - Intronic
1153131995 18:1865113-1865135 AAAAGGCAACTATAAAATCAGGG + Intergenic
1156037032 18:32776053-32776075 ACCAGACCACTAGAAACTAATGG - Intergenic
1156796810 18:41055700-41055722 GCCAGGTAACTAGAAACTGCTGG + Intergenic
1158503789 18:58027867-58027889 TCCATGCAACTATAAAATAATGG + Intergenic
1159716193 18:71826389-71826411 ACCAGACAACTCTCAACTGAGGG - Intergenic
1160688493 19:448748-448770 ACCAGGCAGACACAAACTGAGGG + Intronic
1165019029 19:32907960-32907982 TGCAGGCAACTATAAACCAATGG - Intronic
1167882259 19:52469948-52469970 ACCAGGTATCTATAAAGTAAGGG + Intronic
926610191 2:14939079-14939101 ACTAGCCCACAATAAACTGAAGG + Intergenic
927392820 2:22614347-22614369 ACAAGGCAACAAGAAATTGATGG + Intergenic
930904606 2:56551478-56551500 ACCAAGTAATTAAAAACTGAAGG + Intergenic
931405438 2:61972680-61972702 ATCAGGCAAATCTCAACTGAGGG + Intronic
938887513 2:135667267-135667289 ACTAGGACAATATAAACTGATGG - Intronic
939601474 2:144197210-144197232 AACAGGCAATTATAATCTTATGG + Intronic
941136921 2:161729017-161729039 ATCAGGAAACTATAAATAGAAGG + Intronic
943110499 2:183598758-183598780 ACCATGCAATTATAAACAGGAGG + Intergenic
943179723 2:184527299-184527321 ATTAGGCACCTATAAACTGCAGG - Intergenic
946126566 2:217568057-217568079 ACCAGACAAGGATAAAATGATGG - Intronic
947949509 2:234135245-234135267 CCCAGGAACCTTTAAACTGATGG - Intergenic
1173358423 20:42317373-42317395 TCCAGAGAACTATAAACTGTGGG - Intronic
1174531078 20:51214732-51214754 ACCATGTAAATATAAATTGAGGG - Intergenic
1182817504 22:33178787-33178809 AACACTCAACTATAAACTGTTGG + Intronic
951306266 3:21066886-21066908 ACAAGGCAACAATAACCTGGAGG + Intergenic
951998868 3:28761364-28761386 ACCAGGCAAGAATCACCTGATGG + Intergenic
953674567 3:44990817-44990839 CCCAGGCAATAGTAAACTGATGG - Intronic
955293672 3:57715760-57715782 ACCAACCAGCTATAAACTGGAGG - Intergenic
957347009 3:78974600-78974622 ACGAGGAAACTCTAAACTGCTGG - Intronic
957673438 3:83335755-83335777 ACTAGGCAAATATAAAGTGAGGG - Intergenic
958731258 3:97962823-97962845 ACCATGCAACTAGTAAATGATGG + Intronic
959380405 3:105634749-105634771 ACCAGGCAGCTGTAAACTGTAGG + Intergenic
962779731 3:138701136-138701158 ATCAGGCAAATCCAAACTGAGGG + Intronic
964179602 3:153867225-153867247 ACCAGGCAAACAAAAACTGAGGG + Intergenic
969943443 4:10758557-10758579 ACAAGGCAATTATAACCAGAAGG - Intergenic
972270982 4:37510707-37510729 ACCAGGCTACTATATGCTCAAGG + Intronic
973294330 4:48499523-48499545 AGAAGCCAACTACAAACTGATGG - Exonic
974615141 4:64270654-64270676 ATCAGGCAACTATCAGGTGATGG + Intergenic
976850988 4:89543995-89544017 TCCAGGCAAACAAAAACTGAGGG + Intergenic
977585363 4:98770193-98770215 ACCAGGCAGCTAAGACCTGAAGG + Intergenic
977623725 4:99166442-99166464 ACAAGGCATCCATATACTGAGGG + Intergenic
979135262 4:117103465-117103487 ATCAGACAAATATAAACAGAGGG + Intergenic
979286296 4:118928670-118928692 ACCAGGCATTTATAAAATAAAGG - Intronic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
979641230 4:123014112-123014134 ACAAGGAAACTAAAAACAGAGGG - Intronic
981773671 4:148339364-148339386 AGTAGGCAACTCTAAAATGATGG + Intronic
981955526 4:150468268-150468290 ACCAGTCATCTATAAAATGAGGG + Intronic
982213393 4:153059433-153059455 ATCTGGCAACTCTAAAATGAGGG + Intergenic
984965383 4:185135508-185135530 ACTAGGCAAATACAAACCGAAGG + Intergenic
988839162 5:35066375-35066397 AACAGATAACTATAAAATGAAGG + Intronic
989109999 5:37897952-37897974 ATCAGACAAATCTAAACTGAGGG - Intergenic
990761913 5:59139081-59139103 ATCAGGAAACTATACACTGCAGG + Intronic
991226673 5:64281473-64281495 ACTAGGCAACTAGGCACTGAAGG - Intronic
991267836 5:64743898-64743920 ATCAGGCAACCATCAAGTGATGG + Intronic
992650473 5:78854780-78854802 CCCAGACAAGTAAAAACTGAGGG - Intronic
993226308 5:85169810-85169832 CCCAGGCAACTAGATACTGGAGG - Intergenic
993784073 5:92107176-92107198 TCCAGGCCACTCTAAACTTAAGG - Intergenic
994044413 5:95291832-95291854 ATCAGGAAACTATTAACTGGAGG + Intergenic
994105306 5:95941297-95941319 AGCAGGCAAAGATAAACTGAGGG + Intronic
996280911 5:121728158-121728180 ATCAGGCAACTATCAGGTGATGG + Intergenic
999056649 5:148585192-148585214 ACCAGGCTACCATATACTGAGGG - Intronic
1001330308 5:170757400-170757422 AGCAGGCAAATATACACTGCTGG + Intergenic
1005439455 6:25850138-25850160 CCCAGGCAACAATAAAAGGAAGG + Exonic
1007336665 6:41159676-41159698 ACAAGGCAACTAGAGCCTGAAGG - Intronic
1007638747 6:43318861-43318883 ACCAGACAGCTTGAAACTGAAGG + Intronic
1012660555 6:101885008-101885030 AGCATGTAACTCTAAACTGAGGG - Intronic
1013812788 6:114063552-114063574 GCAGGGCAACCATAAACTGAAGG + Intronic
1013968410 6:115984454-115984476 ACCACTCAACTATTAAGTGATGG + Intronic
1015025075 6:128522115-128522137 CCCAGGTAACAAAAAACTGAGGG + Intergenic
1015043872 6:128755779-128755801 ATCTGGCAACTATAGAATGAAGG - Intergenic
1016615242 6:146040468-146040490 CCCAGGCAAACAAAAACTGAGGG - Intronic
1017711668 6:157174438-157174460 AACAGGAAGCTATAAACTGAAGG - Intronic
1019206073 6:170363058-170363080 ACACGGCAAAGATAAACTGATGG - Intronic
1022581091 7:31555559-31555581 ACCTGGCAATTACAAACAGAAGG + Intronic
1023808575 7:43892855-43892877 CCCAGACAAGTAAAAACTGAGGG + Intronic
1025822883 7:64986551-64986573 ACCATGGAAATATAAATTGATGG - Intronic
1026066726 7:67081148-67081170 CCCAGACAAGTAAAAACTGAGGG - Intronic
1028972898 7:96878251-96878273 CCCAGACAAATAAAAACTGAGGG + Intergenic
1030075137 7:105730324-105730346 ATCAGGCAAATATCAACAGAAGG + Intronic
1030985119 7:116232177-116232199 ACCAGGCAATTCCAATCTGAAGG + Intronic
1034701049 7:153096223-153096245 GCCAGGCAAATCCAAACTGAGGG + Intergenic
1037469121 8:19190249-19190271 ATCAGGCAAATCTAAACTCAAGG + Intergenic
1038185210 8:25267124-25267146 ACCAAGCAAGTATATACAGATGG + Intronic
1041823491 8:62065335-62065357 CCCAGGCAAATAAAAGCTGAGGG + Intergenic
1042300612 8:67276502-67276524 TCTGGGCAAATATAAACTGAAGG + Intronic
1042700512 8:71607361-71607383 ACAGGGCAATTATGAACTGAAGG + Intergenic
1042945821 8:74153554-74153576 ACTAGCCAACTATCAACTCAGGG + Intergenic
1045281405 8:100752847-100752869 ACCAGGCACCTAGAAAATGTGGG + Intergenic
1045561243 8:103265707-103265729 ACCAGGCAAGTAGAAAATAAAGG + Intergenic
1046016131 8:108607496-108607518 ACCTGATAACTATAAAATGATGG + Intronic
1046121761 8:109856208-109856230 ACCAGCCAGCTATAAACTGGGGG + Intergenic
1047068277 8:121312617-121312639 TCCAGGCAAATAAAAGCTGAAGG - Intergenic
1050225442 9:3449429-3449451 ACCAGGCAGGTAAAAACTGAGGG - Intronic
1050906595 9:11013498-11013520 CCCAGGCAAAGAAAAACTGAGGG - Intergenic
1051002303 9:12298472-12298494 ATCAGGGAACTGCAAACTGAAGG - Intergenic
1055937260 9:81614644-81614666 ACCAGGTAAGGATTAACTGAAGG + Intronic
1059846971 9:118290718-118290740 ACAAGGCAACTTTAAAATTATGG - Intergenic
1187543791 X:20226999-20227021 ACAAAGCAACTGTAAACTTAAGG - Intronic
1190151004 X:47948111-47948133 CCCAGACAAATAAAAACTGAGGG + Intronic
1191912897 X:66170529-66170551 AACAGGCAAATAAAAACTGCTGG - Intronic
1193543844 X:82803129-82803151 ACCATGCAGCCATAAAATGATGG - Intergenic
1197714610 X:129697419-129697441 CCCAGGTAACTTTCAACTGATGG - Intergenic
1198296091 X:135288157-135288179 AGAAGGCAACTATCAACAGAAGG + Intronic