ID: 1095462496

View in Genome Browser
Species Human (GRCh38)
Location 12:42457311-42457333
Sequence CCTGAAGAAATGCAGGTATA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 236}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095462496 Original CRISPR CCTGAAGAAATGCAGGTATA AGG (reversed) Exonic
901428283 1:9197438-9197460 CCTGCAGGGATGAAGGTATAAGG - Intergenic
904909381 1:33922487-33922509 CCAGAAGAAAAGCAGGTCTTGGG + Intronic
905237614 1:36560884-36560906 CCTGGAGAAGTGCAGGTCTCTGG - Intergenic
905599332 1:39235610-39235632 CCTGAACAAAAGCAGCGATATGG - Intronic
908275207 1:62463811-62463833 CCTGAAGGAATGGAGGGAAATGG + Intronic
908362121 1:63379346-63379368 CCTGGGCAAATGCAGGCATATGG + Intronic
908932866 1:69338759-69338781 GGTGAAGAAATGAAGGCATAAGG + Intergenic
909031524 1:70546874-70546896 CCTGAACAAATGCAGATTTCAGG - Intergenic
912022409 1:105121531-105121553 CATGGAGAAATGCAAGGATATGG - Intergenic
912748417 1:112265391-112265413 GCTGAAGAAATGAAGGTGCAAGG - Intergenic
913970128 1:143408574-143408596 ACTTAAGAAATGCAAGTAAAGGG - Intergenic
914064503 1:144234171-144234193 ACTTAAGAAATGCAAGTAAAGGG - Intergenic
914114647 1:144732183-144732205 ACTTAAGAAATGCAAGTAAAGGG + Intergenic
914454488 1:147823240-147823262 CTCAAAGACATGCAGGTATATGG - Intergenic
918737803 1:188088266-188088288 TCTGAAGGAATTCAGCTATATGG + Intergenic
919352949 1:196483115-196483137 CCTGAAGAGAGGCAGGTGAATGG + Intronic
921521662 1:216163435-216163457 CCTCAAGTAATTCAGATATATGG - Intronic
922462941 1:225826979-225827001 CCTACAGAACTGCAGGAATAAGG + Intronic
924017310 1:239741370-239741392 CCTGAATACTTCCAGGTATAGGG + Intronic
924144584 1:241060883-241060905 CCAGAAGGAATACAGGTATAAGG + Intronic
1063560863 10:7125805-7125827 CCTGAGGAAATGCTGTTATAAGG + Intergenic
1066009798 10:31184219-31184241 CATGAAGAAATGCTTTTATATGG + Intergenic
1066710227 10:38225250-38225272 CCTGAAGAAATGAAGATACGTGG - Intergenic
1068499906 10:57831662-57831684 CCTGATGAAATTAAGATATAAGG - Intergenic
1069346526 10:67476771-67476793 CCTGGAGATATGCAGGGGTATGG - Intronic
1070074811 10:73124538-73124560 CCTAAAGACATGCAGATCTATGG + Intronic
1070551284 10:77492554-77492576 GATGATGAAATGGAGGTATAGGG + Intronic
1071672831 10:87626048-87626070 CCTTTAGAAATGCAAGTTTAGGG + Intergenic
1072161611 10:92771976-92771998 CCTTAAGAAAGCCAGGGATATGG - Intergenic
1074751123 10:116588304-116588326 CCTGAAGGAAAGCAGATATTTGG + Intergenic
1074862942 10:117526162-117526184 CCTGAAGCAATGCAGTTGTCAGG + Intergenic
1077851504 11:6077952-6077974 CCTGGAGAATTACAGGTAAATGG - Intergenic
1079538527 11:21544097-21544119 CATGAAGCAATACAGGCATATGG + Intronic
1083095179 11:60242946-60242968 CCTGAAGAAAGGTAGGTCCAGGG - Intronic
1083098671 11:60280706-60280728 CCTGAAGAAAGGTAGGTCCAGGG + Exonic
1084732207 11:71080878-71080900 CCTGAATGAATGCAGGAACACGG + Intronic
1086002328 11:81998286-81998308 CCTGCAGAAAGGCTGGTAAATGG - Intergenic
1086725414 11:90176613-90176635 CCTGATGATATGCAGGTACTTGG + Intronic
1087202174 11:95356850-95356872 CCTCTAGGAATGCAGGTACATGG - Intergenic
1087812621 11:102624334-102624356 CCTAAAGAAATGGATGTCTACGG - Intronic
1088613149 11:111598663-111598685 CCTGAAGAAATACATATATGTGG - Intergenic
1088861297 11:113802170-113802192 TCTGAAGTAATGCAATTATAGGG - Intronic
1089819183 11:121207667-121207689 CCATAAGCAAAGCAGGTATAAGG - Intergenic
1091997686 12:5007604-5007626 GCTGAAGAAAGGAGGGTATAAGG + Intergenic
1094246668 12:28304604-28304626 CCTGAAGAAAGACATTTATAAGG - Intronic
1095462496 12:42457311-42457333 CCTGAAGAAATGCAGGTATAAGG - Exonic
1096023813 12:48343959-48343981 ACAGAAGAAATGAAGGTTTAGGG - Intronic
1097093103 12:56523177-56523199 CCTGAAGAAATATGGGTAGAGGG + Intronic
1098854730 12:75639146-75639168 CCTTTAAAAATCCAGGTATAAGG - Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1099782283 12:87211457-87211479 GCTGAAGAAATTCAGCTAAATGG - Intergenic
1100571022 12:95842921-95842943 CTAGAAGAAATGAAGATATAGGG + Intergenic
1104146228 12:126036322-126036344 CCAGAAGGAAAGCAGGTGTATGG + Intergenic
1104275731 12:127325780-127325802 TCTGGAGTCATGCAGGTATAAGG + Intergenic
1107533486 13:41306566-41306588 CTGGAAGACATGCACGTATATGG + Intergenic
1108438538 13:50425556-50425578 CCTGAGGAAATGAAGATATGGGG - Intronic
1108860617 13:54854135-54854157 CCTGAAGAATTGCAGGGGTGGGG - Intergenic
1109620591 13:64900144-64900166 CATGCAGAAATGCAGGCATTTGG + Intergenic
1110638221 13:77790903-77790925 CATGCAGAAATTCAGGTATTTGG + Intergenic
1110754076 13:79151334-79151356 CCTCAAGAAAAGCAGATAGACGG - Intergenic
1111144044 13:84157444-84157466 CAGGAAGAAATCCAGGTATTTGG - Intergenic
1114734862 14:25033920-25033942 CCTGAGAAAATGCAGGTATATGG + Intronic
1116229869 14:42202816-42202838 CCTTTAGAAATGCAAATATAAGG + Intergenic
1117139003 14:52767151-52767173 CCTAAAGAGATGCACGTATTTGG + Intronic
1120027549 14:79603381-79603403 CCAGAAGATATGCAGGGACAGGG - Intronic
1120434511 14:84464011-84464033 CCAGCAGAAATGCAGCTATGGGG - Intergenic
1120710855 14:87791607-87791629 CCTGATCAAATGCAGATAAAAGG - Intergenic
1121374174 14:93391015-93391037 TCTGAAGAAAAGCAGCAATATGG + Intronic
1122269836 14:100563925-100563947 GCTGAAGGAATCCAGGTATGAGG + Intronic
1124052591 15:26211648-26211670 CCTGGAGAAATGATGGTATAAGG + Intergenic
1125019073 15:34967475-34967497 ACTGCAAAAATGCAGGTATATGG + Intronic
1125958142 15:43805368-43805390 CCTAAAGTCATGCAGGTATGGGG - Exonic
1126534570 15:49747469-49747491 CCTGAAGAACTGTAGATATGTGG + Intergenic
1129200758 15:73997831-73997853 CCTGAATAAATGGGGGTATTGGG + Intronic
1129893086 15:79084768-79084790 GCTGAAGACAAGCAGGTTTATGG - Intronic
1129926463 15:79368785-79368807 CCTTTAGAAATGCAAATATAAGG + Intronic
1131167652 15:90154006-90154028 CCTGATGAAATCCAGATGTAAGG + Intergenic
1131374197 15:91910108-91910130 CCTGGGGAAAGGCAGGAATATGG - Intronic
1131449746 15:92529371-92529393 CATGAAGATATGCAGCTTTAGGG - Intergenic
1131524786 15:93144059-93144081 CCAGAAGAAATGCAAATAGATGG + Intergenic
1131946324 15:97626175-97626197 CCAGAAGAAATACAGTTATTTGG + Intergenic
1134343131 16:13363629-13363651 CTGGAACAAATGCAGGGATATGG + Intergenic
1134854665 16:17508372-17508394 CCTGAGGAAATACCGGTATGGGG + Intergenic
1139249321 16:65479879-65479901 CCTGAAGAAATAGAGGTAGGAGG + Intergenic
1139271395 16:65686827-65686849 CTTGAGAAAATGAAGGTATATGG + Intergenic
1146316742 17:31813333-31813355 AAGGAAGAAATGAAGGTATAAGG - Intergenic
1149207232 17:54262553-54262575 ATTGAAGAACTGCATGTATAGGG - Intergenic
1150030417 17:61728581-61728603 TCTCAGGAAATGGAGGTATAAGG + Intronic
1150544269 17:66137030-66137052 CCTAAAGAAATGAAGGTAAATGG + Intronic
1151460923 17:74253513-74253535 CCTGGAGAAATGCAGCTTTTTGG - Intronic
1153463881 18:5367299-5367321 AGTGAAGAAATGCATATATAGGG - Intergenic
1153756593 18:8289949-8289971 CCTGAACAAAGGCAGGCAAAAGG - Intronic
1154018943 18:10645558-10645580 ACAGAAGAAATGAAGGGATAGGG + Intergenic
1154185272 18:12177664-12177686 ACAGAAGAAATGAAGGGATAGGG - Intergenic
1156090667 18:33465002-33465024 CCAGAAGAAAACCAGGTATTTGG - Intergenic
1156263765 18:35467861-35467883 CCTGGGGAAATGCGGGTATAGGG + Intronic
1157103207 18:44748665-44748687 CCAGGAGCAATGCAGGTAAAGGG + Intronic
1158409920 18:57196696-57196718 CATTAAGACATGCAGGTATTTGG - Intergenic
1159896333 18:74000617-74000639 CCTGAAGAAATAGAGATATGTGG - Intergenic
1166768330 19:45265559-45265581 TAAGAAGAAGTGCAGGTATAAGG + Intronic
927453678 2:23230961-23230983 CCTGAGCAAATGCAGGCATCGGG - Intergenic
928034035 2:27805290-27805312 CCTCAAGAAAATCAGGTCTATGG - Intronic
928179117 2:29055316-29055338 CCTTTAGAAATGCAACTATACGG - Exonic
928673458 2:33626309-33626331 CCTTTAGTGATGCAGGTATAAGG - Intergenic
930610273 2:53534855-53534877 CCTGGAACAATGCAGGTATTAGG - Intronic
931188536 2:59977123-59977145 AATGAAGAAATTAAGGTATAGGG + Intergenic
934174820 2:89569483-89569505 ACTTAAGAAATGCAAGTAAAGGG - Intergenic
934285137 2:91643835-91643857 ACTTAAGAAATGCAAGTAAAGGG - Intergenic
934476992 2:94600234-94600256 CCTGAAGAATTGTAGACATAAGG - Intronic
935373295 2:102369930-102369952 GATGAAGAAATGAAGGTAGAGGG + Intronic
936595605 2:113844561-113844583 CCTGAAGAAGTGAGGGTAAAGGG + Intergenic
939414311 2:141873682-141873704 CTTGAAGAAATGCTGGTTTCAGG + Intronic
941334479 2:164225462-164225484 CCATAAGAAATGCAAGTATGGGG - Intergenic
942089758 2:172478513-172478535 GCACAAGAAATGCAGGTATGCGG - Intronic
942401942 2:175611968-175611990 CATGTAGAAATGCAGGTAGGTGG - Intergenic
942695997 2:178646484-178646506 CCTGAAGAAATACCAGTAAAAGG - Exonic
943342004 2:186693428-186693450 CCTGAAGAAATGCTGGCACATGG + Intergenic
943609738 2:190018627-190018649 CCTGCAGAAATGAAGATCTATGG - Intronic
944389694 2:199204741-199204763 CCTTAAGAAGTGCAGGAATTTGG - Intergenic
945352367 2:208796261-208796283 CCAGAAGAAACGCAGGCCTATGG + Intronic
947444616 2:230154599-230154621 GCTGATGTAATTCAGGTATAGGG + Intergenic
1169809074 20:9590766-9590788 CCTGAAGAAATGCAGTTTGTTGG + Intronic
1170020005 20:11826896-11826918 ACTGAAGAATTACAGGTAAATGG + Intergenic
1170251941 20:14292933-14292955 CCTGAATAAATGCATGAATGAGG - Intronic
1171879472 20:30607121-30607143 CCTCAAGACATGCACATATAAGG + Intergenic
1174526942 20:51180069-51180091 GCTGGAGAGATGCAGGTATCTGG - Intergenic
1175184520 20:57170985-57171007 CCTGAAGAAATACAGAAACATGG - Exonic
1179343005 21:40530709-40530731 CCTGAGGAAATGTGGGTTTAGGG - Intronic
1180880290 22:19198592-19198614 CCTGAAGAAATGGAAGGATTTGG - Intronic
1182579830 22:31300179-31300201 CCTGAGGAAAAGCAGGTTTGGGG + Intergenic
1184004067 22:41696220-41696242 GCTGAAGAGATCCAGGTACAAGG + Exonic
949107357 3:216812-216834 CCTTAAGCAATGCTGATATATGG + Intronic
949932011 3:9086174-9086196 ATTGCAGAAATGCAGGAATAGGG - Intronic
950912314 3:16606859-16606881 GTTGATGAAATGCAGGTCTAGGG - Intronic
951607304 3:24450289-24450311 CCTGCAGAGAGGCAGGTAAATGG + Intronic
952976710 3:38702746-38702768 CCTAAGCAAATGCAGGTATAGGG + Intronic
956003746 3:64756604-64756626 CCTGAACAAATGAAGGTCTATGG + Intergenic
956640563 3:71411835-71411857 GATGAAGAAATGGAGGTGTATGG - Intronic
959483901 3:106906415-106906437 CGTCTAGAAGTGCAGGTATAGGG - Intergenic
959730679 3:109598015-109598037 CTTGAAGAAATGCATGTTAAGGG - Intergenic
959948260 3:112149876-112149898 CAGGTAGAAATGCAGGTATGTGG - Intronic
960521670 3:118662307-118662329 CCTGAAGAAAACCTGGTCTAGGG + Intergenic
961580446 3:127876366-127876388 CCAGGAGAAATGCAGGTCGATGG - Intergenic
961721380 3:128898987-128899009 CTTGAAGAAATGCAGTTGTCTGG + Intronic
962372203 3:134830090-134830112 ACTGGAGAAATGCAGGTGAAGGG - Intronic
963254501 3:143131299-143131321 CCTTAAGTAATGCAGATAAATGG + Intergenic
964989787 3:162794900-162794922 CCTGAAGAAAGGGAGGGAGACGG + Intergenic
966457594 3:180135371-180135393 CCAGAAGAAATGCAGTTTTCTGG + Intergenic
967432966 3:189409412-189409434 CCTGTAGAAATGGAAGTGTATGG + Intergenic
969828671 4:9778418-9778440 ACTTAAGAAATGCAAGTAAAGGG - Intronic
970078865 4:12256613-12256635 CCTGAAAATATGCAGCTTTATGG + Intergenic
973724130 4:53755166-53755188 CCTAAAGAAAGGCAGATCTATGG + Intronic
974012442 4:56618985-56619007 CATGAAGAAAGGCAGACATATGG + Intergenic
974692657 4:65318018-65318040 GCTGGAGAAATGCTGATATATGG - Intergenic
975011200 4:69354723-69354745 CCTGTGTAAATGCAGGTAGAGGG + Intronic
975915908 4:79325367-79325389 CCTGAAGAAGGGCGGGTATGTGG - Exonic
976868915 4:89766859-89766881 GCTGAAGAAATTCAGCTACATGG - Intronic
977522841 4:98107446-98107468 CCTGAAGAAATGTATGAATATGG - Intronic
978491167 4:109313709-109313731 CCTGAACAACTGAAGGTATCTGG + Intergenic
979420507 4:120499354-120499376 CATTAAGAAATGAAGGCATATGG + Intergenic
981050366 4:140303727-140303749 CCTGTGCAAATCCAGGTATAGGG + Intronic
981339267 4:143601843-143601865 CCTGAAGAAATACTTTTATAAGG - Intronic
981853467 4:149258865-149258887 AATGAAGAAATGCAAGGATATGG - Intergenic
983112224 4:163766385-163766407 CCTTTAGAAATGTAGGTAAAAGG - Intronic
984123900 4:175781297-175781319 CCTGAAGAAATGAAGGGAAGGGG + Intronic
985747875 5:1657390-1657412 CGTGAAGAGATGCAGGGAGAAGG - Intergenic
986647486 5:9931801-9931823 CCTGAAGGATTGCATGAATAAGG + Intergenic
986860581 5:11922247-11922269 CCTGGAGAAATTAAGGAATAGGG + Intergenic
988332527 5:29860716-29860738 CCTGAAGTTATGGAGTTATAGGG - Intergenic
989788706 5:45364416-45364438 CTTGAAGACATGCAGGAAAAAGG - Intronic
991123664 5:63045325-63045347 GCTTAATAAATGCAGTTATATGG - Intergenic
992010524 5:72521652-72521674 GATTAAGAAATGCAGGAATAGGG + Intergenic
993533433 5:89051082-89051104 CCTTAACAAATGCAGGTCTCAGG + Intergenic
994035580 5:95196183-95196205 GCTGAATAAATGCAGGGATACGG + Intronic
994591050 5:101772491-101772513 CCTGAAGAAATTCAGCAATTGGG - Intergenic
994867985 5:105302947-105302969 CCTTATGAAATACAGGTAGAGGG - Intergenic
996603939 5:125298540-125298562 CCAGATTAAGTGCAGGTATAAGG - Intergenic
996651121 5:125877950-125877972 ACTGAAGAAATGAAAGTATATGG + Intergenic
996984260 5:129539427-129539449 CTAGAAGGAATGCAGCTATATGG + Intronic
997477660 5:134154950-134154972 CCTTGTGAAATGCAGGTACAGGG - Exonic
1002193551 5:177490862-177490884 CCTGAAGAAATCAAGGTACAGGG - Exonic
1003210223 6:4056828-4056850 CCTTAAAAAATGGAGGTGTAGGG - Intronic
1003641657 6:7880295-7880317 TCTGAAAAAATACAGGAATATGG + Exonic
1004774860 6:18832395-18832417 CCTGATGAATTGCAAGTAAATGG + Intergenic
1005002646 6:21258605-21258627 CCTGCAGATAGGCAGGTATGGGG + Intergenic
1005920406 6:30396452-30396474 CCTGAAGAAACACAGGGAGAAGG - Intergenic
1007380493 6:41487501-41487523 CCAGAGGAAATGGAGGTATAGGG - Intergenic
1008481408 6:51989837-51989859 CCAGAGGAAATGAAGGGATAGGG + Intronic
1011762035 6:90577651-90577673 CCAGAAGGAAAGCAGATATAAGG + Intronic
1011884357 6:92075792-92075814 CCTCAAGAAATGGAGGTACCAGG + Intergenic
1013050540 6:106530251-106530273 ACTGAAGAAATGCAGGGATTTGG + Exonic
1013246942 6:108295504-108295526 CTTGAAGAGATGCAGGTGTGGGG + Intronic
1013445832 6:110225611-110225633 CCTGCAGCAATGCAGGTGGATGG - Intronic
1016550977 6:145279739-145279761 CATGAATAAATGCAGGGACATGG + Intergenic
1020444060 7:8249855-8249877 TCTGAAGTGATGCAGGTATTTGG + Intronic
1020717369 7:11692201-11692223 CCTGAAAACATTCAGGTATTTGG + Intronic
1020717402 7:11692852-11692874 CCTGAAGAATTTCAGCTATTTGG - Intronic
1020821912 7:12980697-12980719 TGTGAATAAATGAAGGTATATGG + Intergenic
1022580406 7:31547765-31547787 CTAGAATAAAAGCAGGTATATGG + Intronic
1023405195 7:39826486-39826508 CCTGAATAAATGGAGGTTTCTGG + Intergenic
1026417324 7:70196001-70196023 CCATAAGAAAGGCAGGTATTGGG + Intronic
1028439887 7:90847846-90847868 CCAGGAGAAATGCAGGTTCAAGG + Intronic
1028522416 7:91747115-91747137 TCTGGAGCAATGCAGCTATATGG - Intronic
1029927888 7:104337225-104337247 TGTGAAGAATGGCAGGTATATGG + Intronic
1032354885 7:131201625-131201647 CCTAAACAAATGCAGGCATTTGG - Intronic
1033056785 7:138062410-138062432 CATGAAGAAAGGTAGGTATTTGG - Intronic
1033710012 7:143933479-143933501 CCTAAAGAAATGGAGATTTATGG - Intergenic
1033943542 7:146685106-146685128 GATGAAGAAATTAAGGTATAGGG + Intronic
1036152219 8:6309172-6309194 GCTGAAGAAATGGAGGCTTACGG - Intergenic
1037326074 8:17692444-17692466 CCTGAAGAAAAGCAGCTTTGAGG - Intronic
1038919091 8:32062578-32062600 CTTGAAAAAATGCAGGAAGAAGG - Intronic
1039388038 8:37153619-37153641 CTTAAAGAAATGAAGGTCTAGGG - Intergenic
1041400026 8:57432960-57432982 CCTAGAGAAATGCAGGAATATGG + Intergenic
1042494247 8:69438380-69438402 CCTGAAGCCATTCAGGTTTATGG - Intergenic
1043732301 8:83698042-83698064 CTTGAAGATATTCAGTTATATGG - Intergenic
1047609657 8:126508668-126508690 CCTCAACAAATTCATGTATAGGG + Intergenic
1048115008 8:131511274-131511296 CTTGAAGAAAAGCATGGATAGGG + Intergenic
1048641802 8:136371492-136371514 GCTGAATAAATCCAGGAATAAGG - Intergenic
1050323815 9:4480517-4480539 AATGAAGAAATGGAGGAATATGG + Intergenic
1052506677 9:29363498-29363520 CCTTAAGAAACACAGGTGTAAGG - Intergenic
1052833856 9:33236035-33236057 ACTGAAGAAGTGCAGGTCCAGGG + Intronic
1053681077 9:40485858-40485880 CCTGAAGAATTGTAGACATAAGG + Intergenic
1053931064 9:43114172-43114194 CCTGAAGAATTGTAGACATAAGG + Intergenic
1054282636 9:63139076-63139098 CCTGAAGAATTGTAGACATAAGG - Intergenic
1054294163 9:63321373-63321395 CCTGAAGAATTGTAGACATAAGG + Intergenic
1054392185 9:64625862-64625884 CCTGAAGAATTGTAGACATAAGG + Intergenic
1054426832 9:65131073-65131095 CCTGAAGAATTGTAGACATAAGG + Intergenic
1054503543 9:65890467-65890489 CCTGAAGAATTGTAGACATAAGG - Intronic
1055311119 9:74981263-74981285 TCTGAAGCAGTGCAGATATAGGG - Exonic
1055495949 9:76855968-76855990 CCTAAAGAAAGGTAGGTAAATGG + Intronic
1055649786 9:78396028-78396050 CCTGAATAAATCCAGTTACAAGG - Intergenic
1059969776 9:119653807-119653829 TCTGAAGGAATACAGGAATATGG - Intergenic
1061999822 9:134210272-134210294 CATGAAGAAAGGCTGGTGTAGGG - Intergenic
1185909811 X:3971113-3971135 CCTGAAGGACTGTGGGTATAAGG + Intergenic
1187820729 X:23285190-23285212 CCTCAAGAAATGGAGGAACATGG - Intergenic
1188605812 X:32028062-32028084 GCTGAATCAATGCAGGTAGAAGG + Intronic
1188882531 X:35506873-35506895 GAAGAAGAAATGCAAGTATAGGG + Intergenic
1190397313 X:49998178-49998200 GATGATGAAATGCAGGCATAGGG + Intronic
1190650105 X:52561145-52561167 ACTGAAGAACTGCATGTTTAGGG - Intergenic
1191870898 X:65743938-65743960 CCAGAAGAAATGCAGCTTTGTGG + Intergenic
1192160974 X:68787258-68787280 CCTGAAGAAAAGAAGGGAAATGG + Intergenic
1192232099 X:69272461-69272483 CCTGAAAAAATGCAAGTCTCTGG - Intergenic
1193597183 X:83461245-83461267 CATAATAAAATGCAGGTATAGGG + Intergenic
1195501155 X:105601640-105601662 CCTGAAGCAATGTAGCTACATGG - Intronic
1198004552 X:132479736-132479758 CATGAAGAAATGCAGGTGTCTGG + Intronic
1198723117 X:139646085-139646107 CCTGAGGAAATGCAGTTTAATGG + Intronic
1199073705 X:143507729-143507751 TCTATAGAAATGCAGGTGTATGG + Intergenic
1199771502 X:150978051-150978073 CCTGAAGATCTGCACTTATAAGG + Intergenic
1199901465 X:152176624-152176646 CTTGAAGAAGAGCAGGTTTAGGG + Intronic
1200875820 Y:8153823-8153845 CCTCATGATATGCAGGTAAAAGG - Intergenic
1200948073 Y:8865681-8865703 CCTGGAGGACTGTAGGTATAAGG + Intergenic
1201532519 Y:15007680-15007702 CAGGGAGAAATGCAGGTATTAGG - Intergenic
1202282147 Y:23200421-23200443 TTTGATGAAATGCAGGTCTAGGG - Intergenic
1202283744 Y:23218098-23218120 TTTGATGAAATGCAGGTCTAGGG + Intergenic
1202433819 Y:24814806-24814828 TTTGATGAAATGCAGGTCTAGGG - Intergenic
1202435420 Y:24832484-24832506 TTTGATGAAATGCAGGTCTAGGG + Intergenic