ID: 1095464103

View in Genome Browser
Species Human (GRCh38)
Location 12:42472686-42472708
Sequence TTACTACTGTCACCACCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095464101_1095464103 -5 Left 1095464101 12:42472668-42472690 CCAGAGAAAGTAACCAAATTACT 0: 1
1: 0
2: 4
3: 23
4: 277
Right 1095464103 12:42472686-42472708 TTACTACTGTCACCACCCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 218
1095464100_1095464103 -4 Left 1095464100 12:42472667-42472689 CCCAGAGAAAGTAACCAAATTAC 0: 1
1: 0
2: 0
3: 31
4: 327
Right 1095464103 12:42472686-42472708 TTACTACTGTCACCACCCCCAGG 0: 1
1: 0
2: 1
3: 15
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095464103 Original CRISPR TTACTACTGTCACCACCCCC AGG Intronic
900334847 1:2157490-2157512 TCACTGCAGTCACCACCTCCTGG + Intronic
902450159 1:16491536-16491558 TGGCTACTGACCCCACCCCCTGG - Intergenic
902502683 1:16921612-16921634 TGGCTACTGACCCCACCCCCTGG + Intronic
903238066 1:21963638-21963660 TTGGGACTGTCACCTCCCCCAGG - Intergenic
905071096 1:35226162-35226184 TCACTACTATCTCCACCTCCTGG + Intergenic
905912010 1:41661868-41661890 CTACTTCTGTCACCACCCTAGGG - Intronic
906409342 1:45566501-45566523 CTTCTACTGTCACCACCCCAAGG - Intronic
906462583 1:46047361-46047383 TCACTACAGCCTCCACCCCCTGG - Intronic
908744693 1:67364314-67364336 TTACTGCAGCCTCCACCCCCTGG - Intronic
911807398 1:102228849-102228871 TCACTGCAGTCTCCACCCCCCGG - Intergenic
915519146 1:156431146-156431168 TTCATACTGTCACCACCCTCTGG + Intergenic
916013488 1:160727707-160727729 TTACTGCAGTCTCCACCTCCTGG + Intergenic
916088079 1:161285652-161285674 GTGTTGCTGTCACCACCCCCAGG + Intergenic
918421116 1:184364878-184364900 TTACTACAGCCTCCACCTCCCGG - Intergenic
918791433 1:188835492-188835514 TTATTACTGTCATCATCACCAGG - Intergenic
919975479 1:202608349-202608371 TTACTACAGCCTCCACCTCCAGG + Intronic
920282934 1:204857992-204858014 TTACTACGGCCTCCACCTCCGGG + Intronic
921670772 1:217921571-217921593 TGACTCCTGTTACCACCTCCGGG + Intergenic
922294510 1:224237877-224237899 TTACTACAGCCTCCACCTCCCGG - Intronic
924037275 1:239950133-239950155 TTACTGCTGTGACCACACTCTGG - Intergenic
924751425 1:246895625-246895647 TTAGTACAGTCAGCACCACCAGG - Intronic
1063475213 10:6322352-6322374 TCACCTCTGTCACCATCCCCAGG + Intergenic
1063996203 10:11622366-11622388 TTACTACAGCCTCCACCTCCTGG - Intergenic
1064963831 10:20995291-20995313 TAGCTGCTGTCCCCACCCCCAGG - Intronic
1065832859 10:29630924-29630946 TCACTTCTCTTACCACCCCCAGG - Intronic
1065857711 10:29843642-29843664 TTACTACGGCCTCCACCTCCTGG - Intergenic
1067040587 10:42951351-42951373 TTAATGCCGTCACCACCCCTTGG + Intergenic
1067230073 10:44399851-44399873 TTCCAACAGTGACCACCCCCAGG - Intergenic
1067566073 10:47338704-47338726 TCACTACAGTCTCCACCTCCTGG - Intergenic
1069824973 10:71249415-71249437 TCACTTTTGTCCCCACCCCCTGG - Intronic
1070887117 10:79911452-79911474 TTTCTACTGTTAACACCCTCTGG + Intergenic
1071527823 10:86367989-86368011 TTACAACTGTCATCTCCTCCAGG - Intergenic
1072338372 10:94421177-94421199 TTCCCCCTGTGACCACCCCCTGG + Intronic
1073061951 10:100738459-100738481 ATACTACCTTCGCCACCCCCTGG + Intronic
1073368900 10:102968986-102969008 TTACTGCAGTCTCCACCTCCTGG + Intronic
1073724498 10:106214046-106214068 TTACTGCTGACAGCAACCCCTGG + Intergenic
1075180112 10:120203833-120203855 TTTCTACTGTAACAACCCCTAGG - Intergenic
1076016886 10:127034893-127034915 TTGCCACTGACCCCACCCCCCGG - Intronic
1077295106 11:1822890-1822912 GTTCCACTGCCACCACCCCCAGG + Intergenic
1077506098 11:2930548-2930570 TTCCTGCTGTAACCACCCCAGGG - Intergenic
1077874350 11:6291383-6291405 ACACTGCTGTCACCACCACCAGG + Intergenic
1077911762 11:6578317-6578339 TTACTGCAGCCTCCACCCCCTGG - Intronic
1079064061 11:17274479-17274501 TCACTACAGTCTCCACCTCCTGG - Intronic
1079467332 11:20743276-20743298 TCACTGCAGCCACCACCCCCCGG - Intronic
1079519543 11:21309845-21309867 TTAATTCAGTCACCTCCCCCTGG + Intronic
1079566531 11:21889870-21889892 TTACTACAGCCTTCACCCCCTGG + Intergenic
1080366634 11:31581826-31581848 TTACTACATCCTCCACCCCCTGG + Intronic
1080398021 11:31907558-31907580 TTACTGCAGTCTCCACCTCCTGG - Intronic
1081041600 11:38221183-38221205 TTACTTCTGACACCAACCACTGG - Intergenic
1081613187 11:44575670-44575692 TTCCTACTGTCAGCAACACCAGG - Intronic
1083447100 11:62715349-62715371 TTACTACTACCACCACCCCCAGG - Exonic
1089420226 11:118326679-118326701 TTACTGCAGTCTCCACCTCCTGG - Intergenic
1090193419 11:124793762-124793784 TTATTCCTGGCACCACCTCCTGG + Intronic
1091593510 12:1859282-1859304 TTACTACAGCCTCCACCTCCCGG - Intronic
1092733669 12:11558565-11558587 TTCCTACTGCCACCAACCCCTGG + Intergenic
1092797105 12:12122755-12122777 TTACTGCAGTCTCCACCTCCCGG - Intronic
1093072500 12:14721551-14721573 TTACTGCAGTCTCCACCTCCTGG - Intergenic
1093248861 12:16774757-16774779 TTACTACAGCCTCCACCTCCTGG + Intergenic
1095464103 12:42472686-42472708 TTACTACTGTCACCACCCCCAGG + Intronic
1095674029 12:44895745-44895767 TTACCACTACCACCACCCCAGGG + Intronic
1096229524 12:49889373-49889395 TTACTTCTCTCCCCAGCCCCAGG + Intronic
1096299129 12:50410478-50410500 TCACTGCAGTCACCACCTCCTGG + Intronic
1096299208 12:50411109-50411131 TTTCTACTGTAACAAACCCCTGG - Intronic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1097217120 12:57422890-57422912 TCACTGCTGTCTCCACCTCCTGG - Intronic
1098432187 12:70432102-70432124 TCACTACAGTCTCCACCTCCTGG + Exonic
1100774600 12:97960412-97960434 ATACTACCAGCACCACCCCCAGG + Intergenic
1101020268 12:100546618-100546640 TTACTGCTGCCTCCACCTCCTGG - Intronic
1101153446 12:101905862-101905884 TTACTGCAGTCTCCACCTCCTGG + Intronic
1103037574 12:117668592-117668614 TAACTGGTCTCACCACCCCCGGG + Intronic
1103120034 12:118372652-118372674 GACCTGCTGTCACCACCCCCGGG + Exonic
1103551307 12:121739545-121739567 TAACTACAGCCACCACCTCCTGG + Intronic
1103832761 12:123793411-123793433 TCACTACAGTCTCCACCTCCTGG + Intronic
1103961376 12:124611115-124611137 TGGCTACTGCCACCACCTCCAGG - Intergenic
1106645722 13:31631483-31631505 TTACTGCTGTAACCACCCAAGGG - Intergenic
1107109947 13:36686088-36686110 CTACTCCTGCCACCACCCACTGG - Intronic
1107901836 13:45024372-45024394 TTACTGCAGTCTCCACCTCCTGG + Intronic
1111790609 13:92850522-92850544 TTACTACAGCCTCCACCTCCTGG - Intronic
1114176199 14:20322695-20322717 TTACTACAATCTCCACCTCCCGG + Intronic
1114343730 14:21772946-21772968 TTTCCACCGTCACCACCACCTGG + Intergenic
1117536946 14:56711480-56711502 TTACTGCAGTCTCCACCTCCTGG - Intronic
1119029166 14:71177993-71178015 CTACCTCTGTCCCCACCCCCAGG + Intergenic
1119592622 14:75904010-75904032 TAACTACTGTAACTACACCCGGG + Intronic
1124050106 15:26189364-26189386 GTGCTCCTGCCACCACCCCCAGG + Intergenic
1124491134 15:30156689-30156711 TTACTACAGCCTCCACCTCCAGG + Intergenic
1126846035 15:52761253-52761275 TTACTTCCTTCACCACCCCCAGG + Intronic
1128066074 15:64765338-64765360 TTACTACAGCCTCCACCTCCTGG - Intronic
1128275782 15:66352623-66352645 TTACCACAGCCACCACACCCCGG + Intronic
1133355319 16:5132170-5132192 TCACTACAGTCTCCACCTCCAGG + Intergenic
1134871910 16:17659612-17659634 GTCCTCCTGTGACCACCCCCAGG - Intergenic
1135208754 16:20505157-20505179 TCACTACAGCCTCCACCCCCTGG - Intergenic
1135570156 16:23543038-23543060 TTACTGCAGTCTCCACCTCCCGG - Intronic
1136398347 16:30005014-30005036 TCACCTCTATCACCACCCCCAGG + Intronic
1138334749 16:56244317-56244339 TTACTACTTTCATGAACCCCAGG - Intronic
1140965748 16:79964431-79964453 TCACTGCAGTCACCACCTCCAGG + Intergenic
1140987367 16:80171203-80171225 CTACTACCATCACCACCACCAGG + Intergenic
1141091994 16:81136819-81136841 TCATTACTGTCACCACCCTTGGG + Intergenic
1141621127 16:85236962-85236984 TGACCACTGTCACCACCCCAAGG + Intergenic
1142476135 17:191517-191539 TGACCACTGTCACCTACCCCTGG + Intergenic
1146195191 17:30805946-30805968 TTACTGCAGTCTCGACCCCCTGG - Intronic
1146634472 17:34493883-34493905 TTAATCCTCTCACCAACCCCAGG - Intergenic
1147007412 17:37414965-37414987 TTACTGCAGTCTCCACCTCCTGG + Intronic
1147460746 17:40566839-40566861 TTACTGCAGTCTCCACCTCCTGG + Intergenic
1148072817 17:44918014-44918036 TTACTGCAGTCTCCACCTCCTGG - Intergenic
1149920502 17:60654427-60654449 TTACTGCAGTCTCCACCTCCTGG - Intronic
1150483355 17:65527592-65527614 CTACTACTGCCACCACTCCGAGG + Intergenic
1154237150 18:12616932-12616954 TCACTGCAGTCTCCACCCCCGGG + Intronic
1155201348 18:23520532-23520554 TCACTACAGTCTCCACCTCCTGG + Intronic
1155931835 18:31716651-31716673 CAACTTCTGCCACCACCCCCAGG - Intergenic
1156412693 18:36849182-36849204 TTACTCCTCTCACCAGCCCCTGG + Intronic
1157547327 18:48555602-48555624 TTAGCACTGCCACCTCCCCCTGG + Intronic
1158638316 18:59180528-59180550 TTTCTATTGGCACCAGCCCCAGG + Intergenic
1159053363 18:63442171-63442193 TTACTACTGGGACCACCCTTTGG - Intergenic
1159443608 18:68512580-68512602 TTACTACAATCTCCACCTCCCGG + Intergenic
1160891388 19:1380552-1380574 TTCCTACTCTCACCCCGCCCTGG + Intergenic
1163692386 19:18744826-18744848 TGACTACTGTCCCCAGCCCTGGG - Intronic
1164857623 19:31537299-31537321 TTACTGCTGCCCCCACCTCCTGG + Intergenic
1165329278 19:35132377-35132399 TTATCACTGTCATCAACCCCAGG + Intronic
926549815 2:14288100-14288122 TCTCTGCTTTCACCACCCCCAGG + Intergenic
926924987 2:17978219-17978241 GTACTACGCTCACCACCACCTGG - Intronic
927568890 2:24140885-24140907 TTACTGCTGCCTCCACCTCCCGG - Intronic
930315817 2:49795810-49795832 TTACCTCTGTCACCCCCCACTGG + Intergenic
930900548 2:56502294-56502316 TTCCTACTTTCAACACCCTCCGG + Intergenic
931243713 2:60475817-60475839 TTCCCACTGCCACCACTCCCCGG + Intronic
931784747 2:65608808-65608830 TACCCACTCTCACCACCCCCAGG - Intergenic
933469359 2:82701291-82701313 TCACTACAGTCTCCACCTCCTGG - Intergenic
933742826 2:85548120-85548142 TTACTGCAGCCACCACCTCCTGG - Exonic
935213053 2:100954762-100954784 TTTCAACTGTCACCACACCTGGG - Intronic
935218545 2:100993002-100993024 TCACTACAGTCTCCACCTCCCGG + Intronic
937116350 2:119407609-119407631 CCATTACTGTCACCACCCCCAGG + Intergenic
938032311 2:128005538-128005560 TCACTGCAGTCTCCACCCCCCGG - Intronic
939169169 2:138674226-138674248 TTACTACAATCTCCACCTCCAGG + Intronic
942403011 2:175623102-175623124 TCACTACAGCCTCCACCCCCAGG - Intergenic
943230367 2:185243049-185243071 CTACTCCTGCCGCCACCCCCTGG - Intergenic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
944724263 2:202454142-202454164 TTACTGCAATCACCACCTCCCGG + Intronic
944762013 2:202825393-202825415 TCACTACAGTCTCCACCACCTGG - Intronic
945103216 2:206282871-206282893 TCCCTTCTGTCACCAGCCCCTGG + Intronic
945452350 2:210008368-210008390 TCACTACAGTCTCCACCTCCTGG + Intronic
949003149 2:241628863-241628885 TTACTGCGGCCACGACCCCCTGG - Intronic
1169878489 20:10322786-10322808 TTTCTCCTTTCACCACCTCCAGG - Intergenic
1170013763 20:11757361-11757383 TTACTACTGCCACCACTTCAGGG + Intergenic
1170211813 20:13853271-13853293 TTACTGCTGCCTCCACCTCCAGG + Intronic
1170534040 20:17322936-17322958 TTACTACAATCTCCACCTCCTGG + Intronic
1172889620 20:38254709-38254731 TTACTGCAGTCTCCACCTCCTGG - Intronic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178550923 21:33538853-33538875 TTACTACAAGCTCCACCCCCTGG + Intronic
1178617103 21:34144146-34144168 TTACTCCTTTCAGCAGCCCCAGG + Intergenic
1182038989 22:27221630-27221652 TCACTACAGTCTCCACCTCCAGG - Intergenic
1182643765 22:31790819-31790841 TCACTGCAGTCTCCACCCCCTGG + Intronic
1182788779 22:32931235-32931257 TTACTACTGCAACCACACCTGGG + Intronic
1183919664 22:41155301-41155323 TCACTACTGTCTCCACCTCCCGG + Intronic
1184559109 22:45251296-45251318 TTACCACGGGCACAACCCCCTGG - Intergenic
1184615257 22:45633589-45633611 TTACTACTGTCATCCGCCCTTGG + Intergenic
1184615369 22:45634372-45634394 TTACTACTGTCATCCGCCCTTGG + Intergenic
1185350347 22:50333062-50333084 TCACTACAGTCTCCACCTCCTGG - Intergenic
1185357002 22:50379419-50379441 TTACTACAGCCTCCACCTCCAGG - Intronic
950569651 3:13792149-13792171 TCCCTACTGCCACCAGCCCCAGG + Intergenic
951035819 3:17930725-17930747 TTACAACTGTAACCATCTCCAGG - Intronic
955037062 3:55278704-55278726 TCACTGCAGTCACCACCTCCTGG - Intergenic
955864341 3:63366942-63366964 TTGCTACTGCCACCACCACCTGG - Intronic
968595722 4:1481980-1482002 TTACTGCAGCCACCACCTCCTGG + Intergenic
969251750 4:5972866-5972888 TGACTACAGTCAGCACCCACGGG - Intronic
971999410 4:34010973-34010995 TTAATATTGTCAGCACCCCAGGG - Intergenic
972452811 4:39220391-39220413 TTACTACAATCACAACCTCCTGG + Intronic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
982770548 4:159392867-159392889 TTACAACTTTCACCACCCTCGGG - Intergenic
983108045 4:163714743-163714765 TCACTGCAGTCACCACCTCCAGG + Intronic
984099810 4:175472025-175472047 TTACTGCTGTAACCACCCAATGG + Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
987887185 5:23828016-23828038 TTAATAGTGTCCCCATCCCCAGG + Intergenic
988299576 5:29404591-29404613 GTACTACTGTAACCACTCTCTGG - Intergenic
989552516 5:42752546-42752568 TTACTGCAGTCTCCACCTCCGGG + Intergenic
992302670 5:75400055-75400077 TCACTACAGTCTCCACCTCCCGG - Intronic
995845485 5:116489347-116489369 CTACTACTGCCACCACACCATGG + Intronic
996387607 5:122925310-122925332 TTACTGCAGTCTCAACCCCCTGG + Intronic
996395950 5:123014239-123014261 TTACTGCAGTCTCCACCTCCTGG + Intronic
996416880 5:123220274-123220296 TGGCTACTGGCACCACCCTCTGG + Intergenic
998196810 5:140080459-140080481 TCACTACAGTCTCCACCTCCTGG - Intergenic
998797151 5:145832706-145832728 TTACTGCTGCCAGCACCCTCAGG - Intronic
1000014731 5:157266620-157266642 TGACCACCGTCACCTCCCCCAGG + Intronic
1000336654 5:160246361-160246383 TGACTACTGCCACCACCACCAGG + Intergenic
1000366706 5:160498027-160498049 TTACTACAGACCCCACCTCCAGG - Intergenic
1001206193 5:169765442-169765464 TTTCTCCTGTCATCACCACCAGG - Intronic
1001415327 5:171541577-171541599 TTACTACTGTCCCTGCCCCAGGG + Intergenic
1004478104 6:15993173-15993195 TTACTACAGCCTCCACCTCCTGG + Intergenic
1007257416 6:40538635-40538657 TTTCTACTGGCACCTCCCCGGGG + Intronic
1014671108 6:124304837-124304859 TCACTACAGTCTCCACCTCCTGG - Intronic
1015979496 6:138824877-138824899 CTACTTCTGGCTCCACCCCCCGG + Intronic
1021728749 7:23575728-23575750 TCACTACAGTCTCCACCGCCAGG + Intergenic
1022209373 7:28193818-28193840 TTACTGCAGTCTCCACCTCCTGG + Intergenic
1024302805 7:47900651-47900673 TCACTGCAGTCTCCACCCCCTGG - Intronic
1026944432 7:74306805-74306827 GTACAAGTGTCACCACCTCCTGG - Intronic
1027626562 7:80552148-80552170 TTACTGCTGTCACCAACTCTGGG + Intronic
1028203024 7:87984753-87984775 TTACTACAGCCTCAACCCCCTGG + Intronic
1029241249 7:99164773-99164795 TTTCTTCTGTCCCCAGCCCCTGG + Intergenic
1029522120 7:101069648-101069670 TCACTACAGCCTCCACCCCCTGG + Intergenic
1029550428 7:101234442-101234464 TGACAACTGTGCCCACCCCCAGG - Exonic
1030335691 7:108323637-108323659 TTACTGCTGTCTCCAGCACCTGG - Intronic
1032124286 7:129181136-129181158 TTACCACTTTCCCCAGCCCCTGG + Intergenic
1033012729 7:137639748-137639770 TTACTGCTGTCACTGCTCCCTGG - Intronic
1033583274 7:142755436-142755458 TCACTACAGTCTCCACCTCCCGG + Intronic
1034554301 7:151840185-151840207 TCCCTACTGTCACCAGCTCCGGG - Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1040853926 8:51929451-51929473 TTACTACAGTCTCAACCTCCCGG + Intergenic
1041640389 8:60193528-60193550 TGACTACTGTAACCACACACTGG + Intronic
1042343913 8:67708656-67708678 ATACTACTTTCACCAACCCATGG + Intronic
1045615127 8:103900296-103900318 TCACTACAGTCTCCACCTCCTGG + Intronic
1045777355 8:105821640-105821662 GTCCTGCTGTAACCACCCCCTGG + Intergenic
1046742950 8:117847773-117847795 TTCCTACTGTTCTCACCCCCAGG + Intronic
1047293554 8:123551326-123551348 TTCCTACTGTCTCCTCTCCCCGG - Intergenic
1047575567 8:126150236-126150258 TTGCTACAGTCACCACACCTGGG + Intergenic
1051384789 9:16495981-16496003 TTACTACAATCTCCACCTCCTGG + Intronic
1051593208 9:18797176-18797198 TGACTACAGACACCACACCCAGG + Intronic
1051813018 9:21072229-21072251 GTACTACTGCCCCCACCCCCAGG + Intergenic
1052807617 9:33026154-33026176 TTACAACTGTCACCGCCTCTAGG + Intronic
1054586805 9:66976197-66976219 CTACTGCCGTCACCATCCCCAGG - Intergenic
1055485528 9:76753102-76753124 TTACTAGAGTCTCCACCTCCTGG + Intronic
1055532617 9:77200412-77200434 TTACTACAGCCTCCACCTCCTGG - Intronic
1056944562 9:90983509-90983531 CTACTTCTCTCTCCACCCCCTGG + Intergenic
1061462130 9:130748485-130748507 TTACTGCAGTCTCCACCTCCTGG + Intronic
1061464805 9:130769404-130769426 TTACTACAGCCTCCACCTCCCGG + Intronic
1062573372 9:137195532-137195554 TTCCTACTGACACCACCTCCTGG - Intronic
1185851416 X:3492343-3492365 TTGCTACTGTCACTTCACCCAGG - Intergenic
1185972394 X:4680032-4680054 TTACTGCTGTCTCAACCTCCTGG + Intergenic
1187525377 X:20049344-20049366 TCACTACAGTCTCCACCTCCTGG + Intronic
1187727697 X:22220738-22220760 ATACTACTAACACCACCCCCTGG - Intronic
1188907860 X:35809680-35809702 TTACTTCTGTAACCAGCCCCAGG + Intergenic
1188946927 X:36316858-36316880 TTACTACAGCCTCCACCTCCCGG + Intronic
1189160204 X:38803376-38803398 TAACTACTGTCACCCTCTCCTGG + Exonic
1191662893 X:63668914-63668936 CTCCTACTGTCACCAACCCAGGG + Intronic
1196172910 X:112609767-112609789 GTACTGCTGCCACCACCACCAGG + Intergenic
1199374144 X:147087866-147087888 GTACTGCTGTAACCACTCCCTGG + Intergenic
1200811378 Y:7488827-7488849 TTGCTACTGTCACTTCACCCAGG + Intergenic