ID: 1095467450

View in Genome Browser
Species Human (GRCh38)
Location 12:42502690-42502712
Sequence ATGTATTTTCAGAGCAGACG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10596
Summary {0: 1, 1: 0, 2: 3, 3: 296, 4: 10296}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095467446_1095467450 20 Left 1095467446 12:42502647-42502669 CCTTTCTACTTTCAACTACCAAG 0: 1
1: 0
2: 1
3: 20
4: 262
Right 1095467450 12:42502690-42502712 ATGTATTTTCAGAGCAGACGCGG 0: 1
1: 0
2: 3
3: 296
4: 10296
1095467448_1095467450 2 Left 1095467448 12:42502665-42502687 CCAAGGATGCACATTTTACACTG 0: 1
1: 0
2: 0
3: 15
4: 301
Right 1095467450 12:42502690-42502712 ATGTATTTTCAGAGCAGACGCGG 0: 1
1: 0
2: 3
3: 296
4: 10296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095467450 Original CRISPR ATGTATTTTCAGAGCAGACG CGG Intronic
Too many off-targets to display for this crispr