ID: 1095475791

View in Genome Browser
Species Human (GRCh38)
Location 12:42586173-42586195
Sequence CACAATAAAGAGAAGGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 333}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095475791_1095475794 0 Left 1095475791 12:42586173-42586195 CCTAACTCCTTCTCTTTATTGTG 0: 1
1: 0
2: 4
3: 29
4: 333
Right 1095475794 12:42586196-42586218 GAATAATCATACATAGATTTAGG 0: 1
1: 0
2: 2
3: 24
4: 320
1095475791_1095475795 28 Left 1095475791 12:42586173-42586195 CCTAACTCCTTCTCTTTATTGTG 0: 1
1: 0
2: 4
3: 29
4: 333
Right 1095475795 12:42586224-42586246 TTAATATTCTCTCACTAATAAGG 0: 1
1: 0
2: 4
3: 20
4: 269
1095475791_1095475796 29 Left 1095475791 12:42586173-42586195 CCTAACTCCTTCTCTTTATTGTG 0: 1
1: 0
2: 4
3: 29
4: 333
Right 1095475796 12:42586225-42586247 TAATATTCTCTCACTAATAAGGG 0: 1
1: 0
2: 2
3: 14
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095475791 Original CRISPR CACAATAAAGAGAAGGAGTT AGG (reversed) Intronic
900074603 1:802980-803002 CAAAATAAAGATAAGTAGTTTGG - Intergenic
900854392 1:5169309-5169331 CACAATGAATAGAAGGAACTTGG + Intergenic
902086364 1:13866013-13866035 CTCATTAAAGTGAAGGATTTTGG - Intergenic
902717894 1:18285134-18285156 GAAAACAAAGAGAAGGAGGTTGG + Intronic
903145825 1:21371427-21371449 AAAAAAAAAAAGAAGGAGTTGGG + Intergenic
903684345 1:25120039-25120061 CACAATAAACACAAGGGATTAGG + Intergenic
904860005 1:33529580-33529602 CACATAAAAAAGAATGAGTTTGG + Intronic
907380290 1:54081629-54081651 GGCAAGAAAGAGAAGGAGTCTGG - Intronic
907721137 1:56973459-56973481 CAAAAAAAAGAGAAGAAGTTTGG - Intergenic
908152192 1:61313410-61313432 AGCAAGAAAGAGAAGGGGTTGGG + Intronic
909454130 1:75831073-75831095 CACAATAAAGGGATGGAGGAAGG + Intronic
910328723 1:86043506-86043528 AAAAATAAAAAGAAGAAGTTTGG - Intronic
911149759 1:94586509-94586531 CACAATAATGAGAATGAATTAGG + Intergenic
911615947 1:100010941-100010963 CATAATAAAGGGAAGCTGTTGGG - Intronic
912639854 1:111334495-111334517 CACAAGAAAGAGAAGCAGACAGG + Intergenic
913296844 1:117329939-117329961 CACAACAAAGAAAAGTATTTAGG - Intergenic
915257180 1:154642802-154642824 TAAAATAAAAAGAATGAGTTTGG - Intergenic
915886726 1:159730398-159730420 CACAATAAAAAGCAGCAGTTTGG + Intergenic
916569636 1:166013944-166013966 CACAATCAAGAAAAGGGGTCAGG - Intergenic
917954995 1:180086138-180086160 CACAATACAGAGATGGAATAGGG + Intronic
920528902 1:206687222-206687244 CAGAATACAGAGCAGAAGTTGGG - Intronic
921038794 1:211409014-211409036 AAAAATAAAGAGAAGAAGTCTGG + Intergenic
922107335 1:222523903-222523925 GACAGTGCAGAGAAGGAGTTAGG + Intronic
922270450 1:224027886-224027908 CAAAATAAAGATAAGTAGTTTGG - Intergenic
1062944327 10:1449152-1449174 GGCAATAAAGAAAAGGAGTGGGG - Intronic
1063177973 10:3569605-3569627 TATCATAAAGAAAAGGAGTTTGG + Intergenic
1063530809 10:6829736-6829758 ATCAAGAAAGAGAAGGAATTAGG - Intergenic
1063568075 10:7189883-7189905 CAAAATAAATGGAAGGAGATGGG + Intronic
1063869666 10:10403924-10403946 CACAGGAAAGAGAATGAGTCTGG + Intergenic
1065029031 10:21566733-21566755 CACAATAAAGAAAAATGGTTTGG - Intronic
1065616535 10:27531733-27531755 GACAAGAGAGAGAAGGAATTGGG + Intronic
1065930046 10:30471335-30471357 CAAAAAAAAAAAAAGGAGTTTGG - Intergenic
1066395990 10:35022208-35022230 AACAATAAAGAGAAGGAAACAGG + Intronic
1067518879 10:46979634-46979656 CACAAAAAAGAGATGGAATTTGG + Intronic
1067643368 10:48072200-48072222 CACAAAAAAGAGATGGAATTTGG - Intergenic
1069871664 10:71536767-71536789 CACAATGAAGAGAAGGGGCCAGG + Intronic
1070357478 10:75654560-75654582 TAGAATAAAGAGAAGGAGAGGGG - Intronic
1070721386 10:78759635-78759657 CTCAATACAAAGAAGGAGCTTGG - Intergenic
1071517585 10:86309140-86309162 CACAATAGAGATAAGGGGCTAGG + Intronic
1071730896 10:88247408-88247430 CAGAAAAAATAGAATGAGTTCGG + Intergenic
1072633129 10:97160601-97160623 CACACCAAAGAGAAAGACTTTGG + Intronic
1073375112 10:103027148-103027170 CACAATAAATTGAAGGAAGTTGG - Intronic
1075411744 10:122233527-122233549 CATGAGCAAGAGAAGGAGTTGGG + Intronic
1075909466 10:126111780-126111802 CATAATAAAGAGAAGCACTGGGG + Intronic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078268903 11:9776545-9776567 GACAATAGAGTGAAGGGGTTTGG + Intergenic
1079142332 11:17820206-17820228 GACAATGAAGAGAAGGGGCTTGG - Intronic
1079368750 11:19832100-19832122 CTCAATAAAGAGAAAAAGATGGG + Intronic
1082269204 11:50151122-50151144 CAAAATAAAGGGAAGGAGGAAGG + Intergenic
1082899552 11:58231248-58231270 CAGAATAAATTGAAGAAGTTAGG + Intergenic
1083411709 11:62498057-62498079 CACAATGAAAAGAACGAGGTAGG + Intronic
1085041685 11:73330659-73330681 CACAGTACAGACAAGGAATTTGG - Intronic
1085425609 11:76402076-76402098 CACACTAAGGAGTAGGAGATAGG - Intronic
1085558381 11:77446805-77446827 AACAATAAAGAGAATGGGTGAGG + Intronic
1085712298 11:78841308-78841330 AACAATAAAGAGAGGCAGTGTGG - Intronic
1085960624 11:81457480-81457502 CAAAATAAATAGAAAGAGATAGG + Intergenic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1087084493 11:94202857-94202879 CCCAAGAAAGACAAGCAGTTAGG + Intergenic
1088952558 11:114586398-114586420 TGAAATAAAAAGAAGGAGTTGGG - Intronic
1089223480 11:116895372-116895394 AATAAAATAGAGAAGGAGTTAGG - Intronic
1089269922 11:117295065-117295087 CACTATACAGAGAAGGAATTAGG - Intronic
1092476610 12:8824050-8824072 CACAAGCAAGAGAAGTAGGTGGG + Intronic
1093146415 12:15571842-15571864 CCCAATAAAGAGAGGGTATTGGG + Intronic
1093333742 12:17875125-17875147 CAAAATAAAGAAAAGCAGTAGGG - Intergenic
1093590161 12:20893333-20893355 CACAAAAATGACAGGGAGTTTGG + Intronic
1094430302 12:30360974-30360996 CACAATAAAAAGAAGAATATAGG - Intergenic
1094717403 12:33026699-33026721 CACAATAAATATAATGAATTGGG - Intergenic
1095232519 12:39757868-39757890 TACAATAAAGAGAAGGATTGAGG + Exonic
1095475791 12:42586173-42586195 CACAATAAAGAGAAGGAGTTAGG - Intronic
1096015457 12:48269124-48269146 CTCAATAAAGAAAAGGATTTGGG - Intergenic
1096386478 12:51198101-51198123 CACAAGAAGGAGAGGGGGTTGGG + Intronic
1097691011 12:62734739-62734761 TTCAATAAAGAGCAGGAGGTGGG + Intronic
1097724358 12:63058028-63058050 AACAATAAAAAGAAGAAGATAGG - Intergenic
1098286765 12:68915032-68915054 CACAATAAAAAGAGGTATTTGGG - Intronic
1098392330 12:69982692-69982714 CACCATGATGAGAAGGAGTCTGG - Intergenic
1098407106 12:70138469-70138491 CATAATAAAGAGAATTAGTAAGG + Intergenic
1098473331 12:70870423-70870445 CAGAATAAAGAGTAGCAGTAGGG - Intronic
1098769710 12:74537918-74537940 CAAAACAAACAGAAGGACTTGGG + Exonic
1099019318 12:77383637-77383659 CACTATAAAGAGGAAGATTTGGG + Intergenic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1099746783 12:86714734-86714756 AATAATACAGAGAAGGAGTGAGG + Intronic
1100499887 12:95163688-95163710 CACATAAAAGAGTAGGAGGTTGG + Intronic
1100741736 12:97601407-97601429 CACAAGAATGAAATGGAGTTTGG - Intergenic
1101795462 12:107969056-107969078 CACAATAAAGGGTAGGAGGAAGG + Intergenic
1103772657 12:123340053-123340075 CACAATAAAGGTTAGGAATTTGG - Intronic
1106123939 13:26884760-26884782 CACAGTATAAAGAAGGAGCTAGG - Intergenic
1107274021 13:38656606-38656628 CATTTTAAAGAGGAGGAGTTGGG - Intergenic
1107626038 13:42285447-42285469 CACAATAAAGAGTAGAAGTGGGG - Intronic
1110667812 13:78138158-78138180 GACATTAAAGAGTAGGTGTTTGG - Intergenic
1110800481 13:79688303-79688325 CAGCATAAAGAAAAGAAGTTGGG + Intergenic
1111676370 13:91394443-91394465 CACAATAAAGAGAACCAAGTTGG - Intergenic
1112110157 13:96287764-96287786 AAGAATAAAAAGAAGGAGATGGG - Intronic
1114960578 14:27883225-27883247 TACCATAAAGGGAAGGGGTTGGG + Intergenic
1115845924 14:37534263-37534285 CACTTTAAATCGAAGGAGTTTGG - Intronic
1116202528 14:41816697-41816719 CAGAATAAAGAGACAAAGTTTGG - Intronic
1117255449 14:53972619-53972641 GACAATAAAGAGAGGGAGGAAGG + Intergenic
1117775216 14:59177076-59177098 CACAAGACAGAGTAAGAGTTTGG - Intergenic
1118196246 14:63629311-63629333 GAGAATAAAGAGATGAAGTTTGG - Intronic
1119851765 14:77871354-77871376 CAAAAAAAAAAGAAGAAGTTAGG - Intronic
1120069251 14:80084545-80084567 CACAATGCAGAGTAGGGGTTTGG - Intergenic
1120084096 14:80249544-80249566 CACAATAAAGGGATGGAGGAAGG - Intronic
1120106521 14:80501761-80501783 CACACCAAAGAAAAGGAGGTGGG - Intronic
1120550085 14:85859664-85859686 CAAAATAAAGAAAGGGAGATGGG + Intergenic
1120674327 14:87403343-87403365 CACAAGGAAGAGAAGTAGGTAGG - Intergenic
1122200420 14:100119241-100119263 CAAAATAAAGAGGATGAGATAGG - Intronic
1122672345 14:103382386-103382408 CACTATAAAGAGTGGGAGATGGG - Intergenic
1202916328 14_GL000194v1_random:176368-176390 AACAAAAAAAAGAAGGGGTTGGG + Intergenic
1124839692 15:33230081-33230103 GACAATGAATAGAAGGATTTTGG + Intergenic
1125256487 15:37769688-37769710 TAAAATACAGAGAAGAAGTTAGG - Intergenic
1125490749 15:40146933-40146955 TACCATAAAGAGAAAGTGTTGGG - Intergenic
1125522807 15:40357659-40357681 AAAAAGAAAGAGAAGGAGCTGGG + Intergenic
1126056417 15:44734032-44734054 CAAAGTAGAGAGAAGGAATTTGG + Intronic
1126839940 15:52708131-52708153 CAAAATGAAGGGAAGGAGGTTGG + Intronic
1126997489 15:54462074-54462096 CACAAAATAGATAAGGATTTGGG + Intronic
1127755223 15:62085628-62085650 CAGAATAAAGAAAATAAGTTAGG + Intergenic
1128102245 15:65012033-65012055 CACAATCAAAAGAATGAATTTGG - Intronic
1130118554 15:81026829-81026851 TACATTATAAAGAAGGAGTTTGG + Intronic
1130964161 15:88685036-88685058 CACAAGGAAGAGATGGGGTTTGG + Intergenic
1132137810 15:99360698-99360720 CACAAGAAATAGAATGAGATTGG + Intronic
1134378188 16:13699210-13699232 CACACTCAAGAGGTGGAGTTAGG - Intergenic
1136360767 16:29778221-29778243 CACAATAAAGGGCAGGAGGAGGG + Exonic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1141005782 16:80350377-80350399 CTCAAAAAAAAAAAGGAGTTGGG - Intergenic
1142336616 16:89493408-89493430 CTCAAAAAAAAAAAGGAGTTGGG + Intronic
1143366983 17:6414852-6414874 CCTTATAAAAAGAAGGAGTTTGG + Intronic
1143525991 17:7472942-7472964 AAAAAAAAAGAGAAGCAGTTGGG - Intronic
1143951579 17:10636936-10636958 GACAATGAAGAAAAGAAGTTTGG - Intronic
1144145548 17:12394458-12394480 CAATAAAAAGAAAAGGAGTTGGG - Intergenic
1144837697 17:18165765-18165787 CTTACTAAAGAGAGGGAGTTTGG - Intronic
1148186504 17:45648494-45648516 CAGAAGAAAGAGAAGAAGTGTGG - Intergenic
1148397147 17:47318095-47318117 AAAAAAAAAGAGAGGGAGTTAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149295409 17:55257603-55257625 CACAATAAAGGGAGGGAAGTTGG + Intergenic
1151458942 17:74243382-74243404 CAGGATAAAGAGCAGGAGGTAGG - Exonic
1153033019 18:732686-732708 CACAGTAAAGGGAAGGAGTGGGG + Intronic
1156575443 18:38309855-38309877 CAGAATAAAGAAAAGCAGTAAGG + Intergenic
1156688290 18:39675970-39675992 CAGGATGAAGAGAATGAGTTGGG + Intergenic
1158133132 18:54175230-54175252 AACAATAAAAAACAGGAGTTTGG - Intronic
1159014948 18:63093735-63093757 TACAGAAAAGAAAAGGAGTTTGG - Intergenic
1159558328 18:69967895-69967917 CACAATAAAGGTAATGTGTTTGG - Intergenic
1160065781 18:75573098-75573120 AACAAGAAAGAGAAGGAGCCAGG - Intergenic
1162585589 19:11556296-11556318 CAAAAAAAAAAGAAAGAGTTGGG - Intronic
1164010455 19:21198963-21198985 GACAATCAAGAGAAAGGGTTTGG + Intergenic
1165177516 19:33941030-33941052 CACAAGAGAGAGAAGGTGCTAGG + Intergenic
1166721357 19:44998346-44998368 CAGGATAACGAGAAGGAGTTCGG - Intergenic
1167969858 19:53182377-53182399 AACAACAAAAAAAAGGAGTTTGG + Intronic
926069973 2:9879546-9879568 CACAAAAAAGAGGATGAGTGGGG + Intronic
926174516 2:10577871-10577893 CACAATAAATGGAAAGAATTAGG + Intronic
928093667 2:28391618-28391640 TCCTATAAAGTGAAGGAGTTTGG - Intergenic
930289480 2:49475581-49475603 AACAATAAGCAAAAGGAGTTTGG + Intergenic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
931868197 2:66433808-66433830 GAGAATAAAGAGAAGGGGTGAGG + Intronic
932306855 2:70710033-70710055 CACTAAACAGAGAAGGAGTGGGG - Intronic
932610170 2:73193043-73193065 GACACTAAAAAGAATGAGTTAGG + Intergenic
933507144 2:83191868-83191890 CTGACTAGAGAGAAGGAGTTAGG - Intergenic
935070175 2:99687140-99687162 CAGAACAAAGAGAAGGATCTAGG + Intronic
936684929 2:114816548-114816570 CACAATCAAGAGATGGGGTGGGG - Intronic
936870034 2:117125754-117125776 CACAAGAAATAGCAAGAGTTGGG - Intergenic
937555402 2:123148399-123148421 CTCAAAAAAGTGAAGGTGTTGGG + Intergenic
938618948 2:133029759-133029781 CACAAAAAAGAAAAGGAAATTGG + Intronic
939555997 2:143674128-143674150 TACAATTAGGAGAAGGATTTTGG - Intronic
939803697 2:146745750-146745772 CTCAATAATGAGAAAGAGTTTGG + Intergenic
940137392 2:150453936-150453958 TACTTTAAAGAGAAGGTGTTAGG - Intergenic
940178487 2:150905288-150905310 AAGAATAAAGAGGAAGAGTTGGG + Intergenic
943381218 2:187151080-187151102 CAGAATAAAGATTAGGGGTTTGG + Intergenic
943386255 2:187206972-187206994 CAAAATGAAGAGAAGGAGTTGGG + Intergenic
943422489 2:187684445-187684467 CACAATAAAATGAATGAGATAGG + Intergenic
944618344 2:201485177-201485199 CACAAGTCAGAGAAGGAGATGGG - Intergenic
945559216 2:211317440-211317462 AACAAAAAAAAGAAGGAGATGGG - Intergenic
946464221 2:219897101-219897123 CACAATCAAGCAAAGGATTTGGG - Intergenic
946523066 2:220487530-220487552 AAGAAAAAAGAGAAGTAGTTAGG - Intergenic
947469561 2:230388072-230388094 CAAAATTAAGTGAAGGTGTTTGG - Intronic
948400578 2:237681937-237681959 CACAATTAAGAATAGGACTTTGG - Intronic
1169830600 20:9820965-9820987 AAGAATAAAGAGAAGAAATTTGG - Intronic
1170730014 20:18965698-18965720 TACAAGAAAGAGACAGAGTTAGG + Intergenic
1170801983 20:19598176-19598198 CACAAAAAATAAAAGGAGATTGG - Intronic
1170950181 20:20929800-20929822 CAAAATAAAGAGGAGGTTTTTGG + Intergenic
1172716086 20:36964739-36964761 CACAGTAAAGGTGAGGAGTTGGG + Intergenic
1172718446 20:36981440-36981462 CACAGTAAAGGTGAGGAGTTGGG - Intergenic
1173039696 20:39450796-39450818 GCCCATAAAGAGAAGCAGTTTGG - Intergenic
1173469476 20:43311669-43311691 CACAAAAGAGAGAAGGAGGGGGG + Intergenic
1174847472 20:53956921-53956943 CAGAATAAAGACATGGAGTCGGG - Intronic
1175161467 20:57011126-57011148 CACAATAAAGAGTAGAAGCAAGG - Intergenic
1176635681 21:9191014-9191036 AACAAAAAAAAGAAGGGGTTGGG + Intergenic
1178131715 21:29580894-29580916 AACAATAAACTGTAGGAGTTGGG - Intronic
1178170897 21:30038771-30038793 AAAAATAAAGAGAAGAAGATGGG + Intergenic
1178602093 21:34003341-34003363 CAAAATAAAGATAAGGCGATGGG - Intergenic
1179217274 21:39378382-39378404 CAAAACAAAGAGCAGGAGTCTGG - Intergenic
1181881486 22:25983855-25983877 GACAAAAAAGCCAAGGAGTTGGG - Intronic
1183848535 22:40563222-40563244 GATAATAAAGAGAAGGAAGTAGG - Intronic
950320379 3:12046953-12046975 GACAATAAAGAGAATGATTATGG + Intronic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951724889 3:25746678-25746700 TACAATAAAGAGCATTAGTTAGG - Intronic
952057728 3:29469425-29469447 AAAAATAAAGGGAAGGTGTTTGG + Intronic
953117736 3:40009541-40009563 CACATTAAAAAGTAGCAGTTGGG - Intronic
953184341 3:40624405-40624427 CACAATAAAGAAAAAGAGATGGG + Intergenic
953779450 3:45853854-45853876 AGCAATAAAGAGGAGAAGTTAGG - Intronic
954553563 3:51501653-51501675 CACATTTAAGAGAAGGAGGATGG - Intergenic
955279275 3:57578800-57578822 CAAAATAAATGGAAGGAATTAGG + Intronic
955510079 3:59671205-59671227 CACAATCAAGAAGAGGAATTAGG - Intergenic
957218100 3:77347839-77347861 CACTCTAAAGAAAAGGATTTGGG - Intronic
957816087 3:85299103-85299125 CACAATAAAGCAAAAGAGATAGG - Intronic
959313953 3:104778218-104778240 CCAAATAAAGAGAAAGAGTATGG - Intergenic
959807834 3:110578966-110578988 CAAAATAAAGAGAAACAGTGTGG + Intergenic
960087636 3:113607913-113607935 CATCATAAAATGAAGGAGTTAGG + Intronic
961068704 3:123899787-123899809 CAGAAAAAAGATCAGGAGTTTGG - Intronic
961379980 3:126490746-126490768 CTGACTAAAGAGAAGGAGTAGGG + Intronic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
963660037 3:148113901-148113923 AACAAAATAGAGAGGGAGTTGGG + Intergenic
963695761 3:148564672-148564694 ATCAAGAAAGAGAAGGAATTAGG - Intergenic
963763138 3:149306122-149306144 GCCAATAAAGAGAAAGAGATAGG - Intergenic
965906455 3:173713221-173713243 AAGAATAAAGAAAAGGAGTTAGG + Intronic
966016546 3:175146284-175146306 CAGAAAAAAGAGAAGGACTGTGG + Intronic
966667725 3:182491067-182491089 CACAAAAATGAAAAGGAGTGTGG - Intergenic
967055938 3:185828240-185828262 CACATGATAGAGAAGGGGTTGGG + Intergenic
969129636 4:4982041-4982063 CACCACACAGAGAGGGAGTTAGG - Intergenic
970310519 4:14777697-14777719 CAACCTAAAGAAAAGGAGTTGGG + Intergenic
970506255 4:16733602-16733624 CAAAATAAAGAGAAAGCCTTGGG + Intronic
970560693 4:17279352-17279374 CTCTATAAGGAGAAGGAGATGGG - Intergenic
971172795 4:24250572-24250594 CACAATAAAAAGAAGGAGGTGGG + Intergenic
971175498 4:24278654-24278676 GAGAAGAAAGGGAAGGAGTTGGG - Intergenic
972124711 4:35748887-35748909 TGCTATATAGAGAAGGAGTTGGG + Intergenic
973741401 4:53922790-53922812 CACACTAAAGAAAAAGAGTTTGG + Intronic
975474461 4:74807264-74807286 CACAATATAGAGGAGGAGATGGG + Intergenic
975774979 4:77776655-77776677 CTAAATGAAGGGAAGGAGTTAGG - Intronic
976734743 4:88298090-88298112 CTCATTAGAGAAAAGGAGTTAGG + Intergenic
976975606 4:91162996-91163018 CACAATAAAAAGAAGTAGAGAGG - Intronic
977638064 4:99323468-99323490 CACAATGAAAAGACGGAGTAGGG - Intergenic
978164966 4:105596254-105596276 AACACAAAAGAGAGGGAGTTAGG + Intronic
978850597 4:113331673-113331695 CACAAGAAAGACAAGCTGTTGGG - Intronic
979450728 4:120867615-120867637 CACAATAAAGGGAAGCAGTTGGG + Intronic
980222761 4:129940929-129940951 CATTATAAAGAGAAGGAGAAGGG - Intergenic
980380157 4:132003364-132003386 CACAAGAAAGAGAAAGAGAGAGG + Intergenic
980773131 4:137404597-137404619 CACAATTAAGAGATGGAATTGGG - Intergenic
982038759 4:151373736-151373758 GACAATAAAGAGACTGACTTGGG - Intergenic
982490787 4:156026644-156026666 CACAATTGAGAGCAGGATTTGGG + Intergenic
983165054 4:164465450-164465472 GCAAATAAATAGAAGGAGTTGGG + Intergenic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
984801451 4:183720942-183720964 ACAAATAAAGAGAAGGAATTAGG - Intergenic
984836797 4:184029857-184029879 TACAATAAACAGAAGGGGCTGGG + Intergenic
985071802 4:186172943-186172965 CACAATCAAGAGAAACAGTGGGG - Intergenic
986196931 5:5545884-5545906 CAGAATAAAGAGAAGCTTTTAGG + Intergenic
987764076 5:22202350-22202372 AACAATAAGGAGAAAGAGATAGG + Intronic
988181021 5:27793875-27793897 TAGAAAAAAGAAAAGGAGTTAGG + Intergenic
988272530 5:29034909-29034931 CACAACAAAGAGAAAGAGTTGGG + Intergenic
988586013 5:32508162-32508184 CACAACAAAGAGTCGGAGGTGGG - Intergenic
988706130 5:33727597-33727619 GACAATAAAGAGAATAAGCTTGG - Intronic
989065061 5:37452062-37452084 CAAAATAAAGAGAATGAAATTGG - Intronic
989351996 5:40497178-40497200 GAAATTAAAGAGAAGAAGTTGGG + Intergenic
989967244 5:50478852-50478874 CAAATTAAAGAGAAGGATATAGG + Intergenic
990893768 5:60675229-60675251 TACAAAATAGAAAAGGAGTTTGG + Intronic
991104148 5:62825095-62825117 CACAATAAAAAGAAGTATGTCGG - Intergenic
991327584 5:65454106-65454128 CACAACAGAGAGAGGAAGTTGGG - Intronic
991382916 5:66050999-66051021 TACAATAAATAGAAGTAGTAAGG + Intronic
991898803 5:71435434-71435456 AACAATAAGGAGAAAGAGATAGG + Intergenic
993579796 5:89646155-89646177 CAAAATAAAGTGAAGGAGGGGGG - Intergenic
993609662 5:90038746-90038768 CACAATATAGAGTAGTAATTTGG + Intergenic
993642991 5:90428365-90428387 CAGAAGAAAGAGAAAGAGTTGGG + Intergenic
993772942 5:91953595-91953617 CAAAATAAAGGTAAGGAGGTAGG + Intergenic
993812751 5:92503160-92503182 AAGAATAAAGAGAAGGAGCAAGG - Intergenic
994202563 5:96994613-96994635 CAAAATAGAGACAAGGTGTTAGG - Intronic
996353831 5:122575263-122575285 CACAAAGGAGAGAAGGATTTGGG - Intergenic
996700040 5:126441574-126441596 CTAAATAAAGAGAAGGAATATGG - Intronic
997448368 5:133960453-133960475 CCCAAAAAAGATATGGAGTTTGG + Intronic
998036009 5:138916681-138916703 AACAATAAAGAAAATGAGCTGGG - Intronic
998834382 5:146189910-146189932 AAGAATAAAGAGAAGAAGGTAGG + Intergenic
999486876 5:152005491-152005513 TACAATAAACAGAGGGAGTTGGG - Intergenic
999808918 5:155109763-155109785 CACATTAAAGAGAAAATGTTTGG - Intergenic
1000106350 5:158062884-158062906 CAAAAAAAAGAGAAAGAGCTAGG - Intergenic
1000256463 5:159543412-159543434 GAAAATAAAGAGAAGGAGTGGGG + Intergenic
1000988115 5:167882988-167883010 CACTATACAGAGGAGGAGTTGGG - Intronic
1001923609 5:175619812-175619834 CTCAGTAAAGGGAAGGAGATGGG - Intergenic
1004035928 6:11923608-11923630 GACAATAAGGAGAAGTACTTTGG - Intergenic
1004045916 6:12022513-12022535 TACTATAAAGACAAAGAGTTTGG + Intronic
1004132344 6:12932481-12932503 TATTATAAATAGAAGGAGTTTGG - Intronic
1004279632 6:14269791-14269813 CTCACTAAAGAAAAGGAGTGAGG - Intergenic
1005167729 6:22944301-22944323 CAGGAGAAAGAGAAGGAGGTGGG + Intergenic
1005441586 6:25874971-25874993 CACAAGAAACTGAAAGAGTTTGG - Intronic
1005521279 6:26602820-26602842 CACATGAGAGAGATGGAGTTTGG + Intergenic
1006680032 6:35790347-35790369 AACAAAAAAGAAAGGGAGTTGGG + Intronic
1006745507 6:36339207-36339229 CACAATAAAAAGAAGGGGAGGGG + Intergenic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007308902 6:40929453-40929475 AAAAAAAAAGAGATGGAGTTTGG - Intergenic
1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG + Intronic
1008942733 6:57064703-57064725 GACAATAAATAGAAGGCTTTTGG - Intergenic
1010260300 6:73807648-73807670 CCTAATAAAGAGAATGACTTTGG - Intronic
1011082743 6:83507715-83507737 TATAAGAAAGAGAAGGAGCTGGG + Intergenic
1011204030 6:84872270-84872292 CACAAGAACGAGAAGGAAATGGG + Intergenic
1011764227 6:90602451-90602473 CAAAAAAAAGAGAACTAGTTAGG - Intergenic
1011831805 6:91382958-91382980 CACAATACAGAGAACAAATTAGG + Intergenic
1012355410 6:98308047-98308069 CACAATAAAAAGAATGAGATCGG - Intergenic
1013687919 6:112607917-112607939 CACACTACACAGAAGTAGTTGGG - Intergenic
1014988118 6:128037035-128037057 CACAACTAAAAGAATGAGTTAGG - Intronic
1015376864 6:132519898-132519920 CACCATTAAGAGAATGAGCTGGG - Intergenic
1016448347 6:144155577-144155599 CACAAGAAAGGGAAGGGTTTTGG + Intronic
1016686316 6:146886278-146886300 CACAATGAAGAGAAGAAGAGGGG - Intergenic
1017225021 6:152010955-152010977 AACAATAATGAGAAGGAGGTAGG - Intronic
1017999099 6:159562982-159563004 CAAAATAAAAAGAAAGAGGTTGG + Intergenic
1018762078 6:166901519-166901541 CACAGTAAAGAGAAGGCCGTGGG + Intronic
1019968608 7:4522187-4522209 CTCAATAAAGATAAGCAGTCAGG + Intergenic
1020028205 7:4914524-4914546 CCCAACAAAGAGAGGGAGCTGGG + Intronic
1021097539 7:16550470-16550492 CAACATAAAGAAAAGGAGTAAGG - Intronic
1021149177 7:17128548-17128570 CACAATAAAAAGTATTAGTTTGG - Intergenic
1021272152 7:18603122-18603144 CACACTAAACAGAAGGATGTTGG - Intronic
1021360176 7:19703301-19703323 TGCAATAAAGAGAAGGAATTGGG + Intronic
1022513758 7:30962322-30962344 CAAAATAAAAACTAGGAGTTAGG - Intronic
1023190978 7:37582339-37582361 CACATGAAACAGAAGGAATTTGG - Intergenic
1024363876 7:48498829-48498851 CACAATGAAGAAAAGAACTTGGG + Intronic
1024600730 7:50978661-50978683 CTCAAGTAAAAGAAGGAGTTGGG - Intergenic
1027537435 7:79422090-79422112 CACACTAAAGAAAATGACTTTGG + Intronic
1028646460 7:93102799-93102821 TACATTAAAAAGAAGGACTTTGG - Exonic
1031267039 7:119594103-119594125 CAGAATAAGAAGAAGAAGTTGGG + Intergenic
1034982318 7:155487092-155487114 CAGAATAAATAGCAGGCGTTGGG - Intronic
1035541033 8:438506-438528 CAAAATAAAGTTAAGTAGTTTGG + Intronic
1036469764 8:9042179-9042201 CACAGAAAAGAGAAGGAACTTGG + Intronic
1037233527 8:16688876-16688898 CACAATGAAGAGAGGTATTTGGG + Intergenic
1037687959 8:21159533-21159555 CAGAATAAAGAGAGGGAGCGGGG + Intergenic
1039124725 8:34188514-34188536 CACAATAAACTGTAGGTGTTTGG + Intergenic
1039229970 8:35433952-35433974 CACAAAATAGAGTAGGAGTCAGG - Intronic
1039583333 8:38684743-38684765 CACTAGAAAGAGAAAGAGGTTGG - Intergenic
1040007770 8:42634985-42635007 CAAAACAAAGAGAAGGTTTTAGG - Intergenic
1040420906 8:47239787-47239809 CAAAGTAAAGATAAGGGGTTAGG + Intergenic
1040608710 8:48961283-48961305 CACAAAAGTGACAAGGAGTTTGG + Intergenic
1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG + Intergenic
1042518767 8:69688191-69688213 GACTATAAATAGAAGGAGCTAGG + Intronic
1043041657 8:75270871-75270893 CACAAAATAGAAAAGGATTTGGG + Intergenic
1043822924 8:84890810-84890832 AACAATAAATAAAAGGAGTTAGG + Intronic
1043877643 8:85504018-85504040 CACAAGAAAGTGATGGAGGTAGG - Intergenic
1045312522 8:101015482-101015504 CACAATAAAGACATGCTGTTAGG + Intergenic
1047041413 8:121000648-121000670 CACAATAAATAGAATGAGATGGG - Intergenic
1047097222 8:121639160-121639182 TAGAATAAAGAGAAGGAAGTTGG - Intronic
1048040048 8:130718387-130718409 TGCAATAAAGATAAAGAGTTGGG + Intergenic
1048870748 8:138795317-138795339 CACAAGAATGAAAAGCAGTTTGG - Intronic
1050241304 9:3638553-3638575 CAAGAAAAAGAGAAAGAGTTGGG - Intergenic
1050381026 9:5030530-5030552 CACATTAAAGATAAAGAATTTGG + Intronic
1050937827 9:11421176-11421198 CACTAGCAAGAGAAGGAGGTAGG + Intergenic
1052002693 9:23306095-23306117 AAAAATAAAGAGAAGCACTTGGG - Intergenic
1052837135 9:33259537-33259559 CAGACTAGAGAGAAGGTGTTAGG + Intronic
1053430828 9:38040756-38040778 CAAAATGAAGAAAAGGAGTTTGG + Intronic
1055081827 9:72275271-72275293 CACAAGAATGGGAAGGAGTGAGG + Intergenic
1055145919 9:72934549-72934571 CACAAAAGTAAGAAGGAGTTGGG - Intronic
1055154047 9:73038934-73038956 CAAAAGACAGAGAAGGATTTTGG - Intronic
1056021417 9:82441749-82441771 AACAACAGAGAGAAAGAGTTGGG - Intergenic
1056315462 9:85385272-85385294 CACGATAAAAAGAAGAAATTGGG - Intergenic
1056705368 9:88948057-88948079 CAGAATTAAGTGAAGGAGGTAGG + Intergenic
1058455968 9:105138479-105138501 CTCAATAAAGAGAAAGAATAGGG - Intergenic
1060003520 9:119979924-119979946 CTCAATAAATAGAAGCTGTTAGG + Intergenic
1060252358 9:121996375-121996397 CTCAATATGGAGAAGGACTTTGG - Intronic
1186436081 X:9544154-9544176 CATAATAATTAGTAGGAGTTTGG - Intronic
1186650769 X:11557760-11557782 CACAATATAAAGTAGGAATTTGG + Intronic
1187997437 X:24943222-24943244 AACTATAAAGAAAAGGAGTGTGG + Intronic
1188483984 X:30662491-30662513 CACAGAAAACAGAAGGATTTTGG - Intronic
1189846463 X:45143201-45143223 AAAAAAAAAGAGAAGAAGTTGGG - Intergenic
1189921524 X:45907596-45907618 CACAGTAACGAGAAGAAATTAGG - Intergenic
1193367016 X:80646809-80646831 CACAGGAGAAAGAAGGAGTTGGG - Intergenic
1195177634 X:102326442-102326464 GAAAGTAAAGAAAAGGAGTTGGG - Intronic
1195181230 X:102360651-102360673 GAAAGTAAAGAAAAGGAGTTGGG + Intronic
1195389889 X:104350598-104350620 GTCAATAAAGAGAAAGAATTTGG + Intergenic
1195419757 X:104661348-104661370 CACCATAAACAGAAGCAGTAAGG - Intronic
1195564562 X:106325789-106325811 CAAAATTAAGAAAAGGATTTTGG - Intergenic
1196177318 X:112653504-112653526 CACAGAAAAAAGAAAGAGTTAGG + Intronic
1196457200 X:115898993-115899015 CTCAGTGAAGAGAAGGAGATTGG + Intergenic
1196593762 X:117519611-117519633 CACAAAAGAGAGAGGGAGTGGGG - Intergenic
1198221072 X:134603015-134603037 CAGAAGAAAGAGAGGCAGTTGGG + Intronic
1199901962 X:152183859-152183881 AGCAATAAAGAGAATGATTTTGG - Intronic
1201670916 Y:16519085-16519107 CAAAATAAAGCGATGGATTTGGG - Intergenic