ID: 1095478609

View in Genome Browser
Species Human (GRCh38)
Location 12:42611019-42611041
Sequence CTGGCCGCACGGTAGGGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095478598_1095478609 11 Left 1095478598 12:42610985-42611007 CCGTGGAGCAGGGGCAGCACTCG No data
Right 1095478609 12:42611019-42611041 CTGGCCGCACGGTAGGGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095478609 Original CRISPR CTGGCCGCACGGTAGGGGCG GGG Intergenic
No off target data available for this crispr