ID: 1095486472

View in Genome Browser
Species Human (GRCh38)
Location 12:42689839-42689861
Sequence GTTCCTGGAGGACCACACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095486466_1095486472 15 Left 1095486466 12:42689801-42689823 CCCAGGGGGAGAGAAACTGTAGA No data
Right 1095486472 12:42689839-42689861 GTTCCTGGAGGACCACACGCTGG No data
1095486467_1095486472 14 Left 1095486467 12:42689802-42689824 CCAGGGGGAGAGAAACTGTAGAG No data
Right 1095486472 12:42689839-42689861 GTTCCTGGAGGACCACACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095486472 Original CRISPR GTTCCTGGAGGACCACACGC TGG Intergenic
No off target data available for this crispr