ID: 1095491637

View in Genome Browser
Species Human (GRCh38)
Location 12:42740618-42740640
Sequence ATAATTCAGCAGTCCCATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095491635_1095491637 6 Left 1095491635 12:42740589-42740611 CCTAATAAAATTAAAGATAAAAC No data
Right 1095491637 12:42740618-42740640 ATAATTCAGCAGTCCCATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095491637 Original CRISPR ATAATTCAGCAGTCCCATTT TGG Intergenic
No off target data available for this crispr