ID: 1095500311

View in Genome Browser
Species Human (GRCh38)
Location 12:42830307-42830329
Sequence GTCCCTGCGGTGGGGAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095500303_1095500311 17 Left 1095500303 12:42830267-42830289 CCAGATGTGACAACCAAAGTGTC No data
Right 1095500311 12:42830307-42830329 GTCCCTGCGGTGGGGAGTGGAGG No data
1095500300_1095500311 20 Left 1095500300 12:42830264-42830286 CCCCCAGATGTGACAACCAAAGT No data
Right 1095500311 12:42830307-42830329 GTCCCTGCGGTGGGGAGTGGAGG No data
1095500305_1095500311 -7 Left 1095500305 12:42830291-42830313 CCAGACATTGCTAAGTGTCCCTG No data
Right 1095500311 12:42830307-42830329 GTCCCTGCGGTGGGGAGTGGAGG No data
1095500304_1095500311 4 Left 1095500304 12:42830280-42830302 CCAAAGTGTCTCCAGACATTGCT No data
Right 1095500311 12:42830307-42830329 GTCCCTGCGGTGGGGAGTGGAGG No data
1095500302_1095500311 18 Left 1095500302 12:42830266-42830288 CCCAGATGTGACAACCAAAGTGT No data
Right 1095500311 12:42830307-42830329 GTCCCTGCGGTGGGGAGTGGAGG No data
1095500301_1095500311 19 Left 1095500301 12:42830265-42830287 CCCCAGATGTGACAACCAAAGTG No data
Right 1095500311 12:42830307-42830329 GTCCCTGCGGTGGGGAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095500311 Original CRISPR GTCCCTGCGGTGGGGAGTGG AGG Intergenic
No off target data available for this crispr