ID: 1095501690

View in Genome Browser
Species Human (GRCh38)
Location 12:42846795-42846817
Sequence CACCTGTAATCACTCCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095501690_1095501698 12 Left 1095501690 12:42846795-42846817 CCACTGGGGAGTGATTACAGGTG No data
Right 1095501698 12:42846830-42846852 GGGTTTGTAGACAGGCCTCTTGG No data
1095501690_1095501692 -10 Left 1095501690 12:42846795-42846817 CCACTGGGGAGTGATTACAGGTG No data
Right 1095501692 12:42846808-42846830 ATTACAGGTGAGGTCACCCATGG No data
1095501690_1095501694 -8 Left 1095501690 12:42846795-42846817 CCACTGGGGAGTGATTACAGGTG No data
Right 1095501694 12:42846810-42846832 TACAGGTGAGGTCACCCATGGGG No data
1095501690_1095501693 -9 Left 1095501690 12:42846795-42846817 CCACTGGGGAGTGATTACAGGTG No data
Right 1095501693 12:42846809-42846831 TTACAGGTGAGGTCACCCATGGG No data
1095501690_1095501699 15 Left 1095501690 12:42846795-42846817 CCACTGGGGAGTGATTACAGGTG No data
Right 1095501699 12:42846833-42846855 TTTGTAGACAGGCCTCTTGGTGG No data
1095501690_1095501695 4 Left 1095501690 12:42846795-42846817 CCACTGGGGAGTGATTACAGGTG No data
Right 1095501695 12:42846822-42846844 CACCCATGGGGTTTGTAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095501690 Original CRISPR CACCTGTAATCACTCCCCAG TGG (reversed) Intergenic
No off target data available for this crispr