ID: 1095501695

View in Genome Browser
Species Human (GRCh38)
Location 12:42846822-42846844
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095501690_1095501695 4 Left 1095501690 12:42846795-42846817 CCACTGGGGAGTGATTACAGGTG No data
Right 1095501695 12:42846822-42846844 CACCCATGGGGTTTGTAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095501695 Original CRISPR CACCCATGGGGTTTGTAGAC AGG Intergenic
No off target data available for this crispr