ID: 1095503530

View in Genome Browser
Species Human (GRCh38)
Location 12:42867262-42867284
Sequence ATGTAGTAGCTAGATTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095503526_1095503530 21 Left 1095503526 12:42867218-42867240 CCATTAAGTTTGAAATCTGAAGT No data
Right 1095503530 12:42867262-42867284 ATGTAGTAGCTAGATTATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095503530 Original CRISPR ATGTAGTAGCTAGATTATGA GGG Intergenic
No off target data available for this crispr