ID: 1095504180

View in Genome Browser
Species Human (GRCh38)
Location 12:42875370-42875392
Sequence AATCATATTCATAAATTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095504180_1095504183 30 Left 1095504180 12:42875370-42875392 CCTTCCAATTTATGAATATGATT No data
Right 1095504183 12:42875423-42875445 CTCAGTAATTTTTTGTCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095504180 Original CRISPR AATCATATTCATAAATTGGA AGG (reversed) Intergenic
No off target data available for this crispr