ID: 1095510713

View in Genome Browser
Species Human (GRCh38)
Location 12:42949026-42949048
Sequence GCACAATGCTTGGCAGATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095510706_1095510713 19 Left 1095510706 12:42948984-42949006 CCAGGGCCTGAGTTATATTCATT No data
Right 1095510713 12:42949026-42949048 GCACAATGCTTGGCAGATAAGGG No data
1095510707_1095510713 13 Left 1095510707 12:42948990-42949012 CCTGAGTTATATTCATTTTTGTA No data
Right 1095510713 12:42949026-42949048 GCACAATGCTTGGCAGATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095510713 Original CRISPR GCACAATGCTTGGCAGATAA GGG Intergenic
No off target data available for this crispr