ID: 1095511852

View in Genome Browser
Species Human (GRCh38)
Location 12:42959574-42959596
Sequence CATCTAGCTGTGTCCTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095511852_1095511855 1 Left 1095511852 12:42959574-42959596 CCCTGGGAGGACACAGCTAGATG No data
Right 1095511855 12:42959598-42959620 TGCCATCTATGAACCAGAAGAGG No data
1095511852_1095511858 17 Left 1095511852 12:42959574-42959596 CCCTGGGAGGACACAGCTAGATG No data
Right 1095511858 12:42959614-42959636 GAAGAGGCCGTCTCCTCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095511852 Original CRISPR CATCTAGCTGTGTCCTCCCA GGG (reversed) Intergenic
No off target data available for this crispr