ID: 1095511855

View in Genome Browser
Species Human (GRCh38)
Location 12:42959598-42959620
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095511843_1095511855 18 Left 1095511843 12:42959557-42959579 CCTTGCCCCTTCCACCACCCTGG No data
Right 1095511855 12:42959598-42959620 TGCCATCTATGAACCAGAAGAGG No data
1095511853_1095511855 0 Left 1095511853 12:42959575-42959597 CCTGGGAGGACACAGCTAGATGG No data
Right 1095511855 12:42959598-42959620 TGCCATCTATGAACCAGAAGAGG No data
1095511847_1095511855 13 Left 1095511847 12:42959562-42959584 CCCCTTCCACCACCCTGGGAGGA No data
Right 1095511855 12:42959598-42959620 TGCCATCTATGAACCAGAAGAGG No data
1095511848_1095511855 12 Left 1095511848 12:42959563-42959585 CCCTTCCACCACCCTGGGAGGAC No data
Right 1095511855 12:42959598-42959620 TGCCATCTATGAACCAGAAGAGG No data
1095511850_1095511855 7 Left 1095511850 12:42959568-42959590 CCACCACCCTGGGAGGACACAGC No data
Right 1095511855 12:42959598-42959620 TGCCATCTATGAACCAGAAGAGG No data
1095511849_1095511855 11 Left 1095511849 12:42959564-42959586 CCTTCCACCACCCTGGGAGGACA No data
Right 1095511855 12:42959598-42959620 TGCCATCTATGAACCAGAAGAGG No data
1095511851_1095511855 4 Left 1095511851 12:42959571-42959593 CCACCCTGGGAGGACACAGCTAG No data
Right 1095511855 12:42959598-42959620 TGCCATCTATGAACCAGAAGAGG No data
1095511852_1095511855 1 Left 1095511852 12:42959574-42959596 CCCTGGGAGGACACAGCTAGATG No data
Right 1095511855 12:42959598-42959620 TGCCATCTATGAACCAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095511855 Original CRISPR TGCCATCTATGAACCAGAAG AGG Intergenic
No off target data available for this crispr