ID: 1095513558

View in Genome Browser
Species Human (GRCh38)
Location 12:42980287-42980309
Sequence AACCCTGAGTTGCCACAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095513558_1095513562 15 Left 1095513558 12:42980287-42980309 CCAGTCTGTGGCAACTCAGGGTT No data
Right 1095513562 12:42980325-42980347 GGTTCTGCACAGCAAGCCTCTGG No data
1095513558_1095513561 -6 Left 1095513558 12:42980287-42980309 CCAGTCTGTGGCAACTCAGGGTT No data
Right 1095513561 12:42980304-42980326 AGGGTTGTCAGGGCTGACTCAGG No data
1095513558_1095513563 16 Left 1095513558 12:42980287-42980309 CCAGTCTGTGGCAACTCAGGGTT No data
Right 1095513563 12:42980326-42980348 GTTCTGCACAGCAAGCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095513558 Original CRISPR AACCCTGAGTTGCCACAGAC TGG (reversed) Intergenic
No off target data available for this crispr