ID: 1095513800

View in Genome Browser
Species Human (GRCh38)
Location 12:42983592-42983614
Sequence TAAAACCGTACAGCATAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095513800_1095513804 6 Left 1095513800 12:42983592-42983614 CCTCCTTATGCTGTACGGTTTTA No data
Right 1095513804 12:42983621-42983643 AACTGGAAATGCTACTGTCTGGG No data
1095513800_1095513803 5 Left 1095513800 12:42983592-42983614 CCTCCTTATGCTGTACGGTTTTA No data
Right 1095513803 12:42983620-42983642 AAACTGGAAATGCTACTGTCTGG No data
1095513800_1095513805 7 Left 1095513800 12:42983592-42983614 CCTCCTTATGCTGTACGGTTTTA No data
Right 1095513805 12:42983622-42983644 ACTGGAAATGCTACTGTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095513800 Original CRISPR TAAAACCGTACAGCATAAGG AGG (reversed) Intergenic
No off target data available for this crispr