ID: 1095513803

View in Genome Browser
Species Human (GRCh38)
Location 12:42983620-42983642
Sequence AAACTGGAAATGCTACTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095513801_1095513803 2 Left 1095513801 12:42983595-42983617 CCTTATGCTGTACGGTTTTAAAT No data
Right 1095513803 12:42983620-42983642 AAACTGGAAATGCTACTGTCTGG No data
1095513797_1095513803 24 Left 1095513797 12:42983573-42983595 CCTGAGGGTGTTTATGGGCCCTC No data
Right 1095513803 12:42983620-42983642 AAACTGGAAATGCTACTGTCTGG No data
1095513800_1095513803 5 Left 1095513800 12:42983592-42983614 CCTCCTTATGCTGTACGGTTTTA No data
Right 1095513803 12:42983620-42983642 AAACTGGAAATGCTACTGTCTGG No data
1095513799_1095513803 6 Left 1095513799 12:42983591-42983613 CCCTCCTTATGCTGTACGGTTTT No data
Right 1095513803 12:42983620-42983642 AAACTGGAAATGCTACTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095513803 Original CRISPR AAACTGGAAATGCTACTGTC TGG Intergenic
No off target data available for this crispr