ID: 1095514326

View in Genome Browser
Species Human (GRCh38)
Location 12:42989636-42989658
Sequence GGGAGGTTGCAGAACCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095514326_1095514331 2 Left 1095514326 12:42989636-42989658 CCATGAGGGTTCTGCAACCTCCC No data
Right 1095514331 12:42989661-42989683 AAAATAGAGCCAACACCCCTGGG No data
1095514326_1095514330 1 Left 1095514326 12:42989636-42989658 CCATGAGGGTTCTGCAACCTCCC No data
Right 1095514330 12:42989660-42989682 GAAAATAGAGCCAACACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095514326 Original CRISPR GGGAGGTTGCAGAACCCTCA TGG (reversed) Intergenic
No off target data available for this crispr