ID: 1095514505

View in Genome Browser
Species Human (GRCh38)
Location 12:42991114-42991136
Sequence GAGTATCAGCATAAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095514505_1095514514 16 Left 1095514505 12:42991114-42991136 CCCACCTCCTTATGCTGATACTC No data
Right 1095514514 12:42991153-42991175 AACTAATTTTTATTCTCTGTAGG No data
1095514505_1095514513 -7 Left 1095514505 12:42991114-42991136 CCCACCTCCTTATGCTGATACTC No data
Right 1095514513 12:42991130-42991152 GATACTCTTAGGGCAGGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095514505 Original CRISPR GAGTATCAGCATAAGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr