ID: 1095514513

View in Genome Browser
Species Human (GRCh38)
Location 12:42991130-42991152
Sequence GATACTCTTAGGGCAGGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095514506_1095514513 -8 Left 1095514506 12:42991115-42991137 CCACCTCCTTATGCTGATACTCT No data
Right 1095514513 12:42991130-42991152 GATACTCTTAGGGCAGGGATTGG No data
1095514503_1095514513 13 Left 1095514503 12:42991094-42991116 CCACAAAACCTAGGCTCTTTCCC No data
Right 1095514513 12:42991130-42991152 GATACTCTTAGGGCAGGGATTGG No data
1095514504_1095514513 5 Left 1095514504 12:42991102-42991124 CCTAGGCTCTTTCCCACCTCCTT No data
Right 1095514513 12:42991130-42991152 GATACTCTTAGGGCAGGGATTGG No data
1095514505_1095514513 -7 Left 1095514505 12:42991114-42991136 CCCACCTCCTTATGCTGATACTC No data
Right 1095514513 12:42991130-42991152 GATACTCTTAGGGCAGGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095514513 Original CRISPR GATACTCTTAGGGCAGGGAT TGG Intergenic
No off target data available for this crispr