ID: 1095514514

View in Genome Browser
Species Human (GRCh38)
Location 12:42991153-42991175
Sequence AACTAATTTTTATTCTCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095514510_1095514514 9 Left 1095514510 12:42991121-42991143 CCTTATGCTGATACTCTTAGGGC No data
Right 1095514514 12:42991153-42991175 AACTAATTTTTATTCTCTGTAGG No data
1095514506_1095514514 15 Left 1095514506 12:42991115-42991137 CCACCTCCTTATGCTGATACTCT No data
Right 1095514514 12:42991153-42991175 AACTAATTTTTATTCTCTGTAGG No data
1095514507_1095514514 12 Left 1095514507 12:42991118-42991140 CCTCCTTATGCTGATACTCTTAG No data
Right 1095514514 12:42991153-42991175 AACTAATTTTTATTCTCTGTAGG No data
1095514505_1095514514 16 Left 1095514505 12:42991114-42991136 CCCACCTCCTTATGCTGATACTC No data
Right 1095514514 12:42991153-42991175 AACTAATTTTTATTCTCTGTAGG No data
1095514504_1095514514 28 Left 1095514504 12:42991102-42991124 CCTAGGCTCTTTCCCACCTCCTT No data
Right 1095514514 12:42991153-42991175 AACTAATTTTTATTCTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095514514 Original CRISPR AACTAATTTTTATTCTCTGT AGG Intergenic
No off target data available for this crispr