ID: 1095520032

View in Genome Browser
Species Human (GRCh38)
Location 12:43052606-43052628
Sequence GGGTGTTCCCAGAAGACTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095520025_1095520032 22 Left 1095520025 12:43052561-43052583 CCAAATGCCTCTTTTTTCAAAGC No data
Right 1095520032 12:43052606-43052628 GGGTGTTCCCAGAAGACTCAAGG No data
1095520024_1095520032 23 Left 1095520024 12:43052560-43052582 CCCAAATGCCTCTTTTTTCAAAG No data
Right 1095520032 12:43052606-43052628 GGGTGTTCCCAGAAGACTCAAGG No data
1095520023_1095520032 24 Left 1095520023 12:43052559-43052581 CCCCAAATGCCTCTTTTTTCAAA No data
Right 1095520032 12:43052606-43052628 GGGTGTTCCCAGAAGACTCAAGG No data
1095520028_1095520032 0 Left 1095520028 12:43052583-43052605 CCAGCAGGCTACGTTACTGACCT No data
Right 1095520032 12:43052606-43052628 GGGTGTTCCCAGAAGACTCAAGG No data
1095520026_1095520032 15 Left 1095520026 12:43052568-43052590 CCTCTTTTTTCAAAGCCAGCAGG No data
Right 1095520032 12:43052606-43052628 GGGTGTTCCCAGAAGACTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095520032 Original CRISPR GGGTGTTCCCAGAAGACTCA AGG Intergenic
No off target data available for this crispr