ID: 1095522948 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:43089073-43089095 |
| Sequence | CTTTGAGTAAGTAGGGAAGG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1095522944_1095522948 | -3 | Left | 1095522944 | 12:43089053-43089075 | CCTACTTGCTGTGGTTAGAACTT | No data | ||
| Right | 1095522948 | 12:43089073-43089095 | CTTTGAGTAAGTAGGGAAGGTGG | No data | ||||
| 1095522941_1095522948 | 24 | Left | 1095522941 | 12:43089026-43089048 | CCAATTTAAATGCCTCTTGTTTA | No data | ||
| Right | 1095522948 | 12:43089073-43089095 | CTTTGAGTAAGTAGGGAAGGTGG | No data | ||||
| 1095522942_1095522948 | 12 | Left | 1095522942 | 12:43089038-43089060 | CCTCTTGTTTAATTGCCTACTTG | No data | ||
| Right | 1095522948 | 12:43089073-43089095 | CTTTGAGTAAGTAGGGAAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1095522948 | Original CRISPR | CTTTGAGTAAGTAGGGAAGG TGG | Intergenic | ||
| No off target data available for this crispr | |||||