ID: 1095522948

View in Genome Browser
Species Human (GRCh38)
Location 12:43089073-43089095
Sequence CTTTGAGTAAGTAGGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095522944_1095522948 -3 Left 1095522944 12:43089053-43089075 CCTACTTGCTGTGGTTAGAACTT No data
Right 1095522948 12:43089073-43089095 CTTTGAGTAAGTAGGGAAGGTGG No data
1095522941_1095522948 24 Left 1095522941 12:43089026-43089048 CCAATTTAAATGCCTCTTGTTTA No data
Right 1095522948 12:43089073-43089095 CTTTGAGTAAGTAGGGAAGGTGG No data
1095522942_1095522948 12 Left 1095522942 12:43089038-43089060 CCTCTTGTTTAATTGCCTACTTG No data
Right 1095522948 12:43089073-43089095 CTTTGAGTAAGTAGGGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095522948 Original CRISPR CTTTGAGTAAGTAGGGAAGG TGG Intergenic
No off target data available for this crispr