ID: 1095523342

View in Genome Browser
Species Human (GRCh38)
Location 12:43094881-43094903
Sequence GAGGCTCTCTAAAGGAATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095523342_1095523351 24 Left 1095523342 12:43094881-43094903 CCAGGATTCCTTTAGAGAGCCTC No data
Right 1095523351 12:43094928-43094950 GTTTCCTTTCCATCTCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095523342 Original CRISPR GAGGCTCTCTAAAGGAATCC TGG (reversed) Intergenic
No off target data available for this crispr