ID: 1095523808

View in Genome Browser
Species Human (GRCh38)
Location 12:43100900-43100922
Sequence TTAAGGTTCTGTAAGTGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095523808_1095523811 19 Left 1095523808 12:43100900-43100922 CCTGAACACTTACAGAACCTTAA No data
Right 1095523811 12:43100942-43100964 TTATTCATGGTTAGATTATTAGG No data
1095523808_1095523810 6 Left 1095523808 12:43100900-43100922 CCTGAACACTTACAGAACCTTAA No data
Right 1095523810 12:43100929-43100951 GAATCATAATTTCTTATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095523808 Original CRISPR TTAAGGTTCTGTAAGTGTTC AGG (reversed) Intergenic
No off target data available for this crispr