ID: 1095523810

View in Genome Browser
Species Human (GRCh38)
Location 12:43100929-43100951
Sequence GAATCATAATTTCTTATTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095523808_1095523810 6 Left 1095523808 12:43100900-43100922 CCTGAACACTTACAGAACCTTAA No data
Right 1095523810 12:43100929-43100951 GAATCATAATTTCTTATTCATGG No data
1095523807_1095523810 19 Left 1095523807 12:43100887-43100909 CCTAAAATTTCAACCTGAACACT No data
Right 1095523810 12:43100929-43100951 GAATCATAATTTCTTATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095523810 Original CRISPR GAATCATAATTTCTTATTCA TGG Intergenic
No off target data available for this crispr