ID: 1095526101

View in Genome Browser
Species Human (GRCh38)
Location 12:43127464-43127486
Sequence TATGGTCCAAAGAATTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095526101_1095526103 11 Left 1095526101 12:43127464-43127486 CCTGGCTAATTCTTTGGACCATA No data
Right 1095526103 12:43127498-43127520 AAAACAAGTAAAGTTTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095526101 Original CRISPR TATGGTCCAAAGAATTAGCC AGG (reversed) Intergenic
No off target data available for this crispr