ID: 1095526103

View in Genome Browser
Species Human (GRCh38)
Location 12:43127498-43127520
Sequence AAAACAAGTAAAGTTTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095526101_1095526103 11 Left 1095526101 12:43127464-43127486 CCTGGCTAATTCTTTGGACCATA No data
Right 1095526103 12:43127498-43127520 AAAACAAGTAAAGTTTCAGATGG No data
1095526099_1095526103 21 Left 1095526099 12:43127454-43127476 CCAAATGATTCCTGGCTAATTCT No data
Right 1095526103 12:43127498-43127520 AAAACAAGTAAAGTTTCAGATGG No data
1095526102_1095526103 -7 Left 1095526102 12:43127482-43127504 CCATATTGAGAATTTGAAAACAA No data
Right 1095526103 12:43127498-43127520 AAAACAAGTAAAGTTTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095526103 Original CRISPR AAAACAAGTAAAGTTTCAGA TGG Intergenic
No off target data available for this crispr