ID: 1095529178

View in Genome Browser
Species Human (GRCh38)
Location 12:43164800-43164822
Sequence ATAAATGTATTTAATCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095529178_1095529186 21 Left 1095529178 12:43164800-43164822 CCAGAAGGATTAAATACATTTAT No data
Right 1095529186 12:43164844-43164866 GTTGCATCCTGTTCTAGGTTTGG No data
1095529178_1095529182 -4 Left 1095529178 12:43164800-43164822 CCAGAAGGATTAAATACATTTAT No data
Right 1095529182 12:43164819-43164841 TTATATTCTGGCCACTTCTGGGG No data
1095529178_1095529187 22 Left 1095529178 12:43164800-43164822 CCAGAAGGATTAAATACATTTAT No data
Right 1095529187 12:43164845-43164867 TTGCATCCTGTTCTAGGTTTGGG No data
1095529178_1095529189 29 Left 1095529178 12:43164800-43164822 CCAGAAGGATTAAATACATTTAT No data
Right 1095529189 12:43164852-43164874 CTGTTCTAGGTTTGGGACACTGG No data
1095529178_1095529180 -6 Left 1095529178 12:43164800-43164822 CCAGAAGGATTAAATACATTTAT No data
Right 1095529180 12:43164817-43164839 ATTTATATTCTGGCCACTTCTGG No data
1095529178_1095529185 16 Left 1095529178 12:43164800-43164822 CCAGAAGGATTAAATACATTTAT No data
Right 1095529185 12:43164839-43164861 GGGGAGTTGCATCCTGTTCTAGG No data
1095529178_1095529183 -3 Left 1095529178 12:43164800-43164822 CCAGAAGGATTAAATACATTTAT No data
Right 1095529183 12:43164820-43164842 TATATTCTGGCCACTTCTGGGGG No data
1095529178_1095529181 -5 Left 1095529178 12:43164800-43164822 CCAGAAGGATTAAATACATTTAT No data
Right 1095529181 12:43164818-43164840 TTTATATTCTGGCCACTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095529178 Original CRISPR ATAAATGTATTTAATCCTTC TGG (reversed) Intergenic