ID: 1095529185

View in Genome Browser
Species Human (GRCh38)
Location 12:43164839-43164861
Sequence GGGGAGTTGCATCCTGTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095529178_1095529185 16 Left 1095529178 12:43164800-43164822 CCAGAAGGATTAAATACATTTAT No data
Right 1095529185 12:43164839-43164861 GGGGAGTTGCATCCTGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095529185 Original CRISPR GGGGAGTTGCATCCTGTTCT AGG Intergenic