ID: 1095532307

View in Genome Browser
Species Human (GRCh38)
Location 12:43202866-43202888
Sequence CTTCATGCCCAAAGTGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095532303_1095532307 22 Left 1095532303 12:43202821-43202843 CCAATGAAGACAAGGTCAGGGCA No data
Right 1095532307 12:43202866-43202888 CTTCATGCCCAAAGTGCACCAGG No data
1095532302_1095532307 23 Left 1095532302 12:43202820-43202842 CCCAATGAAGACAAGGTCAGGGC No data
Right 1095532307 12:43202866-43202888 CTTCATGCCCAAAGTGCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095532307 Original CRISPR CTTCATGCCCAAAGTGCACC AGG Intergenic
No off target data available for this crispr