ID: 1095532398

View in Genome Browser
Species Human (GRCh38)
Location 12:43203673-43203695
Sequence AAAATTATGAGACATAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095532395_1095532398 15 Left 1095532395 12:43203635-43203657 CCAGAGTACGTTTTCACACGAAG No data
Right 1095532398 12:43203673-43203695 AAAATTATGAGACATAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095532398 Original CRISPR AAAATTATGAGACATAAAGC AGG Intergenic
No off target data available for this crispr