ID: 1095540199

View in Genome Browser
Species Human (GRCh38)
Location 12:43300948-43300970
Sequence CATACTAATCCCTTGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095540192_1095540199 29 Left 1095540192 12:43300896-43300918 CCAAAAGGTATTTTGTGGAAAAG No data
Right 1095540199 12:43300948-43300970 CATACTAATCCCTTGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095540199 Original CRISPR CATACTAATCCCTTGGAGGC AGG Intergenic
No off target data available for this crispr