ID: 1095550079

View in Genome Browser
Species Human (GRCh38)
Location 12:43425984-43426006
Sequence ACCTATAAGATAATGTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095550075_1095550079 26 Left 1095550075 12:43425935-43425957 CCAGATTTTGAGGATTAGTATCA 0: 1
1: 0
2: 3
3: 18
4: 200
Right 1095550079 12:43425984-43426006 ACCTATAAGATAATGTTGGCAGG 0: 1
1: 0
2: 2
3: 8
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095550079 Original CRISPR ACCTATAAGATAATGTTGGC AGG Intronic
905321361 1:37119669-37119691 ACCTTTGAAATAATGTTTGCTGG + Intergenic
906077975 1:43066156-43066178 ACTTAAAAGATCATCTTGGCTGG - Intergenic
907365516 1:53955922-53955944 GGCTAAAAGATTATGTTGGCCGG - Intronic
909311204 1:74151697-74151719 ACCTGTAAGAGAGTTTTGGCTGG - Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
916940666 1:169673799-169673821 ACCTAAAAGTTAATGGTGGGGGG + Intronic
917297298 1:173533828-173533850 ACCTATACAGTAATGTTGGGGGG + Intronic
917342421 1:173993721-173993743 ATCTAAAAAATAATCTTGGCTGG + Intronic
919307006 1:195855138-195855160 CTCTATTAGATCATGTTGGCTGG - Intergenic
919521028 1:198586995-198587017 TCCTATAAGATAATATTATCTGG + Intergenic
919929765 1:202213703-202213725 CCCCATAAGATAATGTTGTGAGG - Intronic
921228287 1:213042944-213042966 ATATATAAGATCATGTTGGCTGG + Intergenic
924488230 1:244508700-244508722 ATATATAAGATTGTGTTGGCTGG + Intronic
1064763286 10:18644538-18644560 AAGTACAAGAAAATGTTGGCCGG + Intronic
1066383854 10:34925038-34925060 ACCTAAAAGATCATGTTGTCTGG - Intergenic
1069094716 10:64244645-64244667 ATCTATAAGAAAATGCAGGCCGG - Intergenic
1071006866 10:80893573-80893595 ATGTATAAGAAAATGGTGGCTGG + Intergenic
1071607047 10:87001703-87001725 CATTATAAGATAATGCTGGCTGG - Intergenic
1075042807 10:119122008-119122030 ACATAAAAGATAATGTTGGCCGG + Intronic
1078163093 11:8858873-8858895 ACCTATATTATAAGGTTGTCTGG + Intronic
1089099095 11:115945849-115945871 ACCTGAAATAAAATGTTGGCAGG + Intergenic
1093665852 12:21811858-21811880 ACCTATAAAATTATGTTTCCAGG - Intronic
1093747438 12:22759396-22759418 AACAAAAAAATAATGTTGGCTGG + Intergenic
1093768936 12:22997773-22997795 ATCTCTCAGATAATGTTGGGTGG + Intergenic
1093973482 12:25396025-25396047 ACCTATCAGCAAATGTTGGCTGG - Intergenic
1095550079 12:43425984-43426006 ACCTATAAGATAATGTTGGCAGG + Intronic
1097070837 12:56353695-56353717 AAATATAATATACTGTTGGCCGG + Intronic
1097669635 12:62520108-62520130 ACCTGTAAGAAAGTGTCGGCAGG - Intronic
1098803227 12:74987905-74987927 ACCTATTAGAAAATCTTGCCAGG + Intergenic
1099085168 12:78237022-78237044 ATCTAAAAGATAAAATTGGCAGG - Intergenic
1099792306 12:87350934-87350956 GTCTTTAATATAATGTTGGCCGG - Intergenic
1100580371 12:95933879-95933901 TCTTAAAATATAATGTTGGCTGG + Intronic
1101032046 12:100670273-100670295 AGATAAATGATAATGTTGGCTGG + Intergenic
1103115273 12:118323562-118323584 ACCTGTAGGATGATGTTGGGGGG + Intronic
1105493961 13:20913920-20913942 ACATATAAGATCATGTCAGCCGG - Intergenic
1105752032 13:23429917-23429939 ACATTTAATATAATATTGGCTGG + Intronic
1106425153 13:29621685-29621707 ATTTTTAAAATAATGTTGGCCGG + Intergenic
1107523351 13:41205120-41205142 ACCTAAAAGATAGTCTTGCCAGG + Intergenic
1108966504 13:56311744-56311766 ACTTATATGACAATGTTGGTTGG - Intergenic
1109185583 13:59263853-59263875 AGGTAAAAGATAATGATGGCTGG + Intergenic
1109908917 13:68885095-68885117 ACTTATAATATTATGTTGCCTGG + Intergenic
1111025355 13:82513911-82513933 ACACAAAAGATATTGTTGGCAGG + Intergenic
1111448041 13:88375835-88375857 AGGTATAAGAAAAGGTTGGCAGG + Intergenic
1120354631 14:83415058-83415080 ACACATTAGATAATGTTGGCTGG + Intergenic
1121864577 14:97350741-97350763 CCCTTTAAGAAAATGTTTGCTGG + Intergenic
1124041368 15:26108438-26108460 AAATATAAGAGAATGTTGGTAGG + Intergenic
1129292954 15:74582462-74582484 AACAATAAGATTATGGTGGCTGG - Intronic
1136154198 16:28371939-28371961 TACTATAAGAAAATGCTGGCCGG + Intergenic
1136208892 16:28743324-28743346 TACTATAAGAAAATGCTGGCCGG - Intergenic
1140306228 16:73805762-73805784 ACGTATAATATAATGCTGGGTGG + Intergenic
1147859039 17:43505843-43505865 ACATATAAGATATTGTTGAAAGG - Intronic
1148230935 17:45934475-45934497 AACTTTAAAAAAATGTTGGCTGG + Intronic
1149222437 17:54430575-54430597 AAGTATAAGAAAATATTGGCAGG - Intergenic
1149744221 17:59079358-59079380 ATCTCTAAGAAAATGCTGGCAGG + Intronic
1149972163 17:61229826-61229848 AATTATAAGATAGTGTTGGCTGG + Intronic
1150453662 17:65289841-65289863 ACTTATAAGGTAATGTTTACTGG + Intergenic
1152186389 17:78858974-78858996 ACATAGAAGAGAATATTGGCCGG - Intronic
1157270085 18:46267776-46267798 ACCTATAAGAAATCTTTGGCTGG + Intergenic
1158013458 18:52756001-52756023 ACTTTTAAGAAAATGTTGGATGG - Intronic
1159270342 18:66141116-66141138 TCCAATAAAATAATTTTGGCTGG + Intergenic
1159368469 18:67500945-67500967 ACCAATAAGATAAGGTTGTTAGG - Intergenic
1160614245 18:80111839-80111861 TTCTAAAAGAAAATGTTGGCCGG - Intronic
1163702803 19:18794780-18794802 ATTCATATGATAATGTTGGCTGG - Intergenic
1164870245 19:31637329-31637351 TCATATAAGAAAATATTGGCCGG - Intergenic
1164877393 19:31701068-31701090 TCCAAAAAGATAGTGTTGGCAGG + Intergenic
1167809396 19:51815263-51815285 CTCTATAAAAAAATGTTGGCTGG + Intronic
927802046 2:26110038-26110060 TTCTAAAAGTTAATGTTGGCCGG + Intronic
937307852 2:120883188-120883210 GCCTAAAAGATAACCTTGGCCGG + Intronic
938833894 2:135079831-135079853 ATCTATAAAATGAGGTTGGCTGG + Intronic
940070710 2:149684511-149684533 GCCTATGCCATAATGTTGGCAGG + Intergenic
944095631 2:195964568-195964590 AACTACAAGATCATATTGGCCGG + Intronic
945464558 2:210153057-210153079 ACATAAAAGATTATGGTGGCTGG + Intronic
948315506 2:237025597-237025619 ACCTAGCAGATTATGTTGGTTGG - Intergenic
1169322689 20:4646613-4646635 ATATATAAGATCATGTTGCCAGG - Intergenic
1177111242 21:17032134-17032156 ACCTATAAGGTAATAATGTCTGG - Intergenic
1177211341 21:18075795-18075817 ACCTATAAGATAATGGCGTTAGG + Intronic
1179285519 21:39974612-39974634 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285532 21:39974686-39974708 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285545 21:39974760-39974782 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285558 21:39974834-39974856 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285571 21:39974908-39974930 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285584 21:39974982-39975004 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
1179285597 21:39975056-39975078 ACCTATAAGAGAAGGGTGGAGGG - Intergenic
950342667 3:12261286-12261308 ACTTTTAAGATAAAGTTGGAAGG + Intergenic
950807109 3:15614891-15614913 AAGAATAAGATATTGTTGGCTGG - Intronic
953740906 3:45538192-45538214 ATCTATATGGAAATGTTGGCAGG + Intronic
954559970 3:51548482-51548504 ATATATATGAAAATGTTGGCTGG - Intronic
956175991 3:66473565-66473587 ACCTAGAAAATAATATTGGAAGG - Intronic
956625252 3:71260277-71260299 ACGTATTAGAAAGTGTTGGCCGG - Intronic
956757274 3:72401271-72401293 AGCTATAACAAAATGTTAGCTGG - Intronic
959400635 3:105897784-105897806 AACTATGATATAATGTTAGCTGG - Intergenic
959887526 3:111519797-111519819 CCCTATAAGTTGGTGTTGGCTGG + Intronic
960970745 3:123138297-123138319 ACCTACAAGATAATGTTAAGGGG - Intronic
961597952 3:128034197-128034219 ACATATTAGAAAATCTTGGCTGG - Intergenic
963227057 3:142873094-142873116 CTCTAAAAGAAAATGTTGGCTGG + Intronic
965120199 3:164544338-164544360 ACCTATAAGATAATATCGAGTGG - Intergenic
965305330 3:167057554-167057576 ACCTATAAGATAATGCACACTGG + Intergenic
969068405 4:4509794-4509816 ACATATAAGAAAATGTTTGAAGG + Intronic
972482205 4:39507598-39507620 ACCTATATTATAACGTTGGTCGG - Intronic
972634433 4:40870673-40870695 ACCTATAAGGTAACATTTGCAGG - Intronic
972862129 4:43182579-43182601 AACTAGAAGTTAATGTAGGCAGG + Intergenic
975170593 4:71227878-71227900 ACCTCTGAGAAAATGTTGGAAGG + Intronic
975362559 4:73488014-73488036 ACCCAAAAGAGAATGGTGGCTGG + Intronic
978306754 4:107336870-107336892 ACTTAAAAGATAAAGTGGGCTGG - Intergenic
978668051 4:111210557-111210579 ACATATAAGAAAATTCTGGCTGG + Intergenic
979656855 4:123205327-123205349 ACATATAAGACAATATTGCCAGG - Intronic
979710022 4:123768742-123768764 ACTTTAAAGATAATCTTGGCAGG + Intergenic
983235926 4:165179239-165179261 ACCTAAAAAGTAATCTTGGCTGG + Intronic
985041305 4:185894245-185894267 ACACAGAAGAAAATGTTGGCAGG + Intronic
987480077 5:18442245-18442267 AACTATAAAATAATGTTGTAAGG - Intergenic
995687704 5:114789022-114789044 ACCTATAGGATAATGTTGGAGGG + Intergenic
996253397 5:121367749-121367771 ACCTATAAGATAGTGATAGAAGG - Intergenic
996905450 5:128594872-128594894 ACATCTGAGATAATGTTGGAAGG + Intronic
997931949 5:138080024-138080046 ATGTATAAGATAATTCTGGCCGG + Intergenic
1000060718 5:157652628-157652650 ACCTATTAGCTAATGTTGCTGGG + Intronic
1002582497 5:180217256-180217278 ACTTATGAGAACATGTTGGCCGG + Intergenic
1004853605 6:19726219-19726241 ACATATAAAATAATATTGGGTGG - Intergenic
1005261842 6:24069595-24069617 ATGAATAAGATAAAGTTGGCAGG + Intergenic
1009040633 6:58172135-58172157 ACCTATATGAGAATGTTTGTTGG + Intergenic
1009216490 6:60926667-60926689 ACCTATATGAGAATGTTTGTTGG + Intergenic
1009429885 6:63554499-63554521 ACCTATTACATAATTTAGGCCGG + Intronic
1010252098 6:73718011-73718033 AAATATAAGATCATATTGGCTGG + Intronic
1012246819 6:96935597-96935619 GCCAAAAAGATAATTTTGGCTGG - Intronic
1012356901 6:98325621-98325643 ACTTATAAGAAAATGTTGTGAGG + Intergenic
1015209618 6:130682573-130682595 TCCTTTAAGAAAGTGTTGGCAGG + Intergenic
1021832737 7:24632681-24632703 ACTTAAAAGAGACTGTTGGCTGG - Intronic
1021887184 7:25150916-25150938 ACCAATATGATAATAATGGCTGG + Intronic
1025766592 7:64460309-64460331 AGTTATAAGATAATGCTGTCTGG - Intergenic
1031145225 7:117990174-117990196 ACCAATAACCTACTGTTGGCTGG - Intergenic
1031146135 7:117999113-117999135 ACTGATAAGATAATGATGACAGG + Intergenic
1032914555 7:136474975-136474997 CCCTATAAAATAATGCTGGAAGG - Intergenic
1033158093 7:138973204-138973226 CCCTATAACTTAATGGTGGCAGG - Intronic
1033260969 7:139843637-139843659 AGCTATAAAATAAAGTGGGCCGG - Intronic
1033605145 7:142921574-142921596 AAGCAAAAGATAATGTTGGCTGG - Intronic
1034831685 7:154313946-154313968 ACCAATAAGAGAACTTTGGCAGG + Intronic
1035004189 7:155643443-155643465 ACGTATAATAAAATGCTGGCCGG - Intronic
1035861071 8:3028182-3028204 ATCGACAAGATGATGTTGGCGGG + Intronic
1037144328 8:15554899-15554921 AATTATAATAAAATGTTGGCCGG - Intronic
1037870224 8:22487325-22487347 ACCTATTACAAAATGCTGGCTGG + Intronic
1039377299 8:37048303-37048325 AGCTATAAGAAAATGTAGGTAGG - Intergenic
1041034963 8:53779860-53779882 ATCTTTAAGATATTGTCGGCTGG + Intronic
1042624728 8:70745128-70745150 ACCAATAAGAAAATGTTTGTTGG - Intronic
1043442079 8:80285048-80285070 GCCTATAAAATAATCTCGGCTGG - Intergenic
1046326489 8:112653952-112653974 ATCAATAAGATAAGGTTGGCTGG - Intronic
1047307943 8:123668466-123668488 GCAAATAAGATAATATTGGCTGG + Intergenic
1047584658 8:126258110-126258132 ACTTATAATATAATCCTGGCAGG + Intergenic
1047720918 8:127638353-127638375 TCCAGTAAGATAATGTAGGCAGG + Intergenic
1048076104 8:131073050-131073072 ACTTATAAGAAAAGGTTAGCAGG + Intergenic
1048628627 8:136215467-136215489 AAGAATAAGATAATTTTGGCTGG + Intergenic
1050024066 9:1315187-1315209 ACCTTCAAGATAATGTTTTCAGG - Intergenic
1053373121 9:37579458-37579480 ACCAAAATGATAATGTTAGCTGG - Intronic
1053549451 9:39060581-39060603 AACTATAAAAAGATGTTGGCCGG + Intergenic
1053813566 9:41880655-41880677 AACTATAAAAAGATGTTGGCCGG + Intergenic
1054617030 9:67306784-67306806 AACTATAAAAAGATGTTGGCCGG - Intergenic
1055449873 9:76421301-76421323 ACAAATAAGTAAATGTTGGCTGG + Intronic
1055777851 9:79785191-79785213 ACCTTTAAGAGGATGGTGGCTGG + Intergenic
1059051903 9:110935490-110935512 ACCTAGAAAAAAATATTGGCTGG + Intronic
1060668557 9:125448216-125448238 ACAGAGAAGGTAATGTTGGCAGG + Intronic
1186544786 X:10437554-10437576 ACCTATAAAACAATGTTGAATGG + Intergenic
1186562546 X:10628409-10628431 ATTTATAAGATAATGTAGACAGG - Intronic
1187146552 X:16642649-16642671 TCCTACAAGATGATGATGGCTGG + Intronic
1190447566 X:50544138-50544160 ACCTTTAAGTTAATGTTAGCTGG - Intergenic
1190454507 X:50614206-50614228 AAATATAAAATAATCTTGGCAGG + Intronic
1192629473 X:72765249-72765271 AGATATAAGATTATGTTGTCTGG + Intergenic
1192652237 X:72955565-72955587 AGATATAAGATTATGTTGTCTGG - Intergenic
1193588602 X:83359103-83359125 AGATATAAGATTATGTTGTCTGG - Intergenic
1194311827 X:92319657-92319679 ACATAGAAGATAATGAAGGCAGG - Intronic
1194613375 X:96071546-96071568 TAATAAAAGATAATGTTGGCTGG - Intergenic
1194835674 X:98679532-98679554 ATTTATAATATAATGTTGGGGGG + Intergenic
1196119627 X:112035923-112035945 ACATATAACATAATATAGGCCGG - Intronic
1198612973 X:138422444-138422466 CACTTTAAGATAATGTTGTCAGG + Intergenic
1199141195 X:144314892-144314914 ACCTACAGGAAAATGTTGGCAGG + Intergenic
1200620097 Y:5433784-5433806 ACATAGAAGATAATGAAGGCAGG - Intronic