ID: 1095552470

View in Genome Browser
Species Human (GRCh38)
Location 12:43459166-43459188
Sequence CAGCAAACAGCAGTGGTAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 3, 2: 40, 3: 115, 4: 361}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095552470_1095552477 23 Left 1095552470 12:43459166-43459188 CCGCCTACCACTGCTGTTTGCTG 0: 1
1: 3
2: 40
3: 115
4: 361
Right 1095552477 12:43459212-43459234 TCCATCCCTCCGGATCCAACAGG 0: 1
1: 17
2: 73
3: 125
4: 220
1095552470_1095552479 24 Left 1095552470 12:43459166-43459188 CCGCCTACCACTGCTGTTTGCTG 0: 1
1: 3
2: 40
3: 115
4: 361
Right 1095552479 12:43459213-43459235 CCATCCCTCCGGATCCAACAGGG 0: 1
1: 25
2: 72
3: 138
4: 217
1095552470_1095552476 13 Left 1095552470 12:43459166-43459188 CCGCCTACCACTGCTGTTTGCTG 0: 1
1: 3
2: 40
3: 115
4: 361
Right 1095552476 12:43459202-43459224 GCTGCTGACTTCCATCCCTCCGG 0: 14
1: 58
2: 95
3: 108
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095552470 Original CRISPR CAGCAAACAGCAGTGGTAGG CGG (reversed) Intronic
900843388 1:5076297-5076319 GAGGAAACATCAGGGGTAGGGGG - Intergenic
901754429 1:11432745-11432767 CAGCTACCAGGAGTGGGAGGAGG - Intergenic
902840419 1:19070639-19070661 CAGCAAAGGGCAGGGGTTGGTGG + Intergenic
902872342 1:19322145-19322167 CAGCAAGCATCAGTGGTGGGGGG + Intronic
903859656 1:26357084-26357106 CAGCAATCAGCAGGGGTCAGAGG + Intergenic
905215935 1:36407608-36407630 CTGTAAACTGCAGTGGTATGAGG + Intergenic
906436170 1:45798530-45798552 CACATGACAGCAGTGGTAGGGGG - Intronic
907195680 1:52684791-52684813 CAGTAAAAAGCAGTGGGTGGGGG - Exonic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907794499 1:57701532-57701554 CATCACACACCAGGGGTAGGGGG + Intronic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
909914011 1:81295323-81295345 AAACAAACAGGAGTGGTAGAAGG - Intergenic
910281125 1:85502821-85502843 CTGCAGACAGAGGTGGTAGGAGG - Intronic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
913070367 1:115293174-115293196 CAGCAAACAGAAGTGGAACTCGG + Intronic
915051746 1:153082699-153082721 CAGCAAAAAGCAGTGCTAACAGG + Intergenic
915053339 1:153101673-153101695 CAGCAAAAAGCAGTGCTAACAGG + Intronic
915902908 1:159858898-159858920 CAGCAGACAGCAGTGCTAGGGGG + Exonic
917372267 1:174306685-174306707 CAAAAAAAAGCAGTGGTAAGGGG - Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918357984 1:183724142-183724164 AAATAATCAGCAGTGGTAGGTGG + Intronic
918667393 1:187168527-187168549 GAGTAAACAGCACTGGCAGGTGG + Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919759663 1:201089487-201089509 CATCAGACAACAGTAGTAGGTGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922597055 1:226822194-226822216 CTGCACTCAGCAGTGGTGGGAGG - Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
924426900 1:243959520-243959542 CAGGAAACAGCAAGGGCAGGAGG + Intergenic
924883962 1:248191947-248191969 CACAACAAAGCAGTGGTAGGAGG + Intergenic
1062927583 10:1328305-1328327 CAGTTAACAGCAGTGGAGGGTGG + Intronic
1062952460 10:1515237-1515259 CAGCACAGAGCAGGGGCAGGCGG + Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1066662954 10:37754462-37754484 CAGCAAACAGCCTTAGAAGGTGG + Intergenic
1066671213 10:37842259-37842281 CAGCAAAATGGAGAGGTAGGTGG + Intronic
1067790276 10:49282648-49282670 CAACAGACAGCAGTGCCAGGAGG - Intergenic
1068276794 10:54810317-54810339 TAGCAAACTGTAATGGTAGGTGG - Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1069735433 10:70650868-70650890 CAGCAAACAGTAGTAATGGGTGG - Intergenic
1070338573 10:75476363-75476385 CTGCAAACAGTTGGGGTAGGAGG - Intronic
1070516093 10:77208291-77208313 CAACCCACAGCAGTGGAAGGTGG - Intronic
1070789501 10:79180960-79180982 CAGAAAAAAGCAGTGGGAGGAGG - Intronic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1073816319 10:107211792-107211814 CAGCAAAAAGCAGTGTTAAGGGG - Intergenic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075009309 10:118854008-118854030 CCGCAAACAGCAGGAGGAGGAGG + Intergenic
1076036454 10:127202382-127202404 CAGCACACAGCGCTGGTGGGTGG - Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076631817 10:131856253-131856275 CAGCGAACAGCACAGGTGGGTGG + Intergenic
1078151710 11:8765164-8765186 CAGCAGACTGCATTGTTAGGGGG - Intronic
1078530357 11:12132123-12132145 CAGGAAGCAGAGGTGGTAGGAGG - Intronic
1078692812 11:13598784-13598806 CAGCAAACCCCAGTGGGAGATGG - Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1083959817 11:66008410-66008432 CAGCACAAAGCAGAGGCAGGTGG + Intergenic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1086008893 11:82074197-82074219 CAGGAAACATCAATGATAGGAGG - Intergenic
1086573823 11:88315214-88315236 CCTCAAACAGCAGAGGTGGGAGG - Intronic
1086610376 11:88748411-88748433 CAGCCAACAGCAGTGGGTTGAGG + Intronic
1087686675 11:101273149-101273171 CAGCAAGCAGAAGAGGTGGGGGG - Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1088922859 11:114274058-114274080 CAGCACTGAGCAGGGGTAGGAGG - Intronic
1088969010 11:114754853-114754875 CAGGGAATAGCAGTGGTTGGTGG + Intergenic
1089300860 11:117497885-117497907 CTGCAAGCAGCAGGGGGAGGAGG - Intronic
1089541271 11:119190395-119190417 CATCAAGCAGCAGTGGGATGGGG - Exonic
1089627577 11:119761435-119761457 CAGCAGACAGAGGTGGTGGGAGG - Intergenic
1089933140 11:122334632-122334654 CAGCTAGAAGCAGTGGTAGGAGG - Intergenic
1091325111 11:134680321-134680343 CAGCAAACAGCAGTGGCTGCTGG - Intergenic
1091402023 12:186922-186944 CAGCAGAGGGCAGTGGTTGGGGG - Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094234227 12:28145324-28145346 CAGCAATGAGAACTGGTAGGAGG + Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1099962071 12:89406501-89406523 CAGCATAGAGCAGTGGCAAGAGG + Intergenic
1101492086 12:105218965-105218987 CTGCCCACATCAGTGGTAGGAGG - Intronic
1101720329 12:107345383-107345405 CAGCAAAGAGAATTGGAAGGAGG + Intronic
1102535175 12:113575849-113575871 CATCAAACAGCAGTGCAAGAAGG - Intergenic
1102785148 12:115598872-115598894 CAACAAACAGCAGGGGGTGGGGG - Intergenic
1102833045 12:116025066-116025088 CAGAACAAAGCAGTGGTGGGGGG - Intronic
1103168221 12:118789290-118789312 CAGGAAACAGCAGTGGGTGATGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1104576143 12:129967518-129967540 CAGCCAACTGAAGTGGTTGGTGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1105782142 13:23714797-23714819 CAGCCAGCTGGAGTGGTAGGAGG - Intergenic
1106077479 13:26473912-26473934 CTGCAGTCAGCAGAGGTAGGAGG - Intergenic
1106289778 13:28350120-28350142 CAGCACACAGGAGTGGAAAGAGG + Intronic
1106619290 13:31358000-31358022 TAGCTAGCAGCAGTGGTGGGAGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1107518325 13:41153862-41153884 GAGCAAGCAGCAGAGGAAGGAGG + Intergenic
1108090666 13:46846400-46846422 CACCAAACAAGAGTGGTTGGAGG - Intronic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110545663 13:76752452-76752474 TTGAAAACAGAAGTGGTAGGGGG - Intergenic
1110600104 13:77363283-77363305 CATCAGACAGGAGAGGTAGGGGG + Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1111990792 13:95114850-95114872 GAGAAAAAAGCAGGGGTAGGGGG + Intronic
1113004179 13:105679755-105679777 CAGCAAACAGCTGTCCCAGGAGG + Intergenic
1113030819 13:105991912-105991934 AAGTAAACAGCTGTTGTAGGTGG - Intergenic
1113592280 13:111509370-111509392 CGGCGATCAGCAGTGGTAGACGG + Intergenic
1114350532 14:21845509-21845531 AAGCAAACAGCAGTGCCATGTGG - Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116740324 14:48746699-48746721 CAACAAACAACAGTGGTGGATGG - Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118135299 14:63018435-63018457 CAGCAGACAGCAATGGTAAAGGG + Intronic
1118592945 14:67414455-67414477 CAGTAAACAGCTGGGGGAGGGGG + Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120244018 14:81984434-81984456 CAGCAAGTATCAGTGGCAGGTGG + Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1121504336 14:94464946-94464968 CAGAAATTAGCAGTGGTTGGAGG - Intronic
1122838422 14:104442738-104442760 CTGAAAACAGCAGTGGGATGAGG + Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123736015 15:23183737-23183759 CAGCAAACAGCAGTAGTAAGAGG - Intergenic
1123982744 15:25619029-25619051 CAGCAAACTGCAGCTGTGGGAGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124286729 15:28406719-28406741 CAGCAAAAAGCAGTAGTAAGAGG - Intergenic
1124295974 15:28504917-28504939 CAGCAAAAAGCAGTAGTAAGAGG + Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126481189 15:49121979-49122001 TTTCACACAGCAGTGGTAGGTGG - Intronic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127218429 15:56849883-56849905 CAGCAAAAAGCAGGGGTCAGAGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1131942869 15:97585854-97585876 CTAGAAGCAGCAGTGGTAGGAGG - Intergenic
1131989576 15:98080305-98080327 GAGCTAACAACAGTGGGAGGTGG - Intergenic
1132204238 15:99975622-99975644 CAGCAGACAGGCGTGGTTGGAGG - Intronic
1133254603 16:4508972-4508994 CAGCAAGCAGCACTGGTGGGCGG - Intronic
1136711492 16:32240601-32240623 CAACAAACAGAAGTGGCAGCGGG - Intergenic
1136756420 16:32688804-32688826 CAACAAACAGAAGTGGCAGCGGG + Intergenic
1136811693 16:33181569-33181591 CAACAAACAGAAGTGGCAGCGGG - Intergenic
1136818169 16:33291649-33291671 CAACAAACAGAAGTGGCAGCGGG - Intronic
1136824733 16:33348178-33348200 CAACAAACAGAAGTGGCAGCGGG - Intergenic
1136829799 16:33446949-33446971 CAACAAACAGAAGTGGCAGCGGG - Intergenic
1136991090 16:35151814-35151836 CAGAAAAGAACAGTGGGAGGAGG - Intergenic
1137841108 16:51641698-51641720 CTGCAAACAGCATTGGTAACTGG - Intergenic
1137900901 16:52267794-52267816 CAGCAAACAGCTCTGGAAAGAGG - Intergenic
1138299639 16:55915390-55915412 GAGAAAAGAGCAGTGGAAGGGGG + Intronic
1140953374 16:79839972-79839994 CAGCACACAGCCGTGGAAGCTGG - Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141649238 16:85384366-85384388 CAGTAAACAGCAGAGGTGGGAGG - Intergenic
1142148314 16:88501843-88501865 TGGCAAACAGCAGTGGCAGGAGG - Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1202990271 16_KI270728v1_random:4538-4560 CAACAAACAGAAGTGGCAGCGGG - Intergenic
1203058562 16_KI270728v1_random:949158-949180 CAACAAACAGAAGTGGCAGCGGG + Intergenic
1144225717 17:13143376-13143398 AAGAAAAAAGCAGTGGGAGGTGG - Intergenic
1145813615 17:27780415-27780437 CAGCTAAGAGCATTGGCAGGAGG + Intronic
1146552117 17:33789852-33789874 CAGTGAACTGCAGTGCTAGGTGG - Intronic
1147911345 17:43858041-43858063 CAGTAAACAGCAGAGGGAGGAGG - Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149254215 17:54806691-54806713 GAGGAAACAACAGGGGTAGGAGG - Intergenic
1150451179 17:65270491-65270513 CAGCAAAGACCAGCGGTAGCTGG + Intergenic
1150712407 17:67543223-67543245 CTGCAGGCAGCAGAGGTAGGGGG - Intronic
1151157902 17:72139707-72139729 CAATAAACATCAGTGGCAGGAGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151412808 17:73942423-73942445 AAGCAAAGAGCAGTGGTTGTTGG + Intergenic
1151594350 17:75067982-75068004 CAGCACACAGCAGTGTTCTGTGG + Intergenic
1152367051 17:79862410-79862432 CTGCAAAAAGCAGAGGAAGGAGG + Intergenic
1152415826 17:80161148-80161170 CAGTAAACAGCAGCAGGAGGAGG + Intergenic
1152447418 17:80353907-80353929 CAGCAAACAGCACAGGGCGGCGG - Intronic
1153316352 18:3726479-3726501 TAGCACACAGGAGTAGTAGGAGG + Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1154169015 18:12037425-12037447 CAGCAAAATGGAGTGGTGGGAGG - Intergenic
1154318422 18:13324837-13324859 AAGAAAACAGCAGAGGTAGGTGG + Intronic
1155397478 18:25402127-25402149 CAGAGAACAGCAGTGTGAGGTGG - Intergenic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156115393 18:33781114-33781136 CAGAAAACAGATGGGGTAGGAGG + Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158574274 18:58623087-58623109 CAGAAAAAAGCAGTGGTGTGAGG + Intronic
1159096924 18:63913427-63913449 CAGCGAAAAGCAGTGTTAGGAGG - Intronic
1159111707 18:64066929-64066951 CAGCAAAAAACAGTGCTAAGAGG - Intergenic
1159365486 18:67461183-67461205 CAGAAAAAAGCAGTGTTAAGAGG - Intergenic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164856395 19:31527868-31527890 CAGCAAAATGCAGTTGTAGAGGG - Intergenic
1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG + Intronic
1165131758 19:33636956-33636978 GGGCAACCAGCAGTGGTTGGGGG - Intronic
1166388681 19:42396824-42396846 CAGCAAACAGCCTAGGTATGTGG + Intergenic
1167573235 19:50303809-50303831 CAGGAAGCAGCAGTAGTATGGGG + Intronic
1167634495 19:50646627-50646649 CAGAAAACACAACTGGTAGGAGG + Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168569095 19:57449888-57449910 CAGCAAACTGGAGTTGTAGGAGG - Intronic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925024922 2:600050-600072 CAGCAAACAGCAGCGCTCAGCGG - Intergenic
926599797 2:14830188-14830210 CAGCAATGAGCAGAGGTAGAGGG + Intergenic
926719766 2:15951274-15951296 ATGCCAACAGCAGAGGTAGGAGG + Intergenic
927060702 2:19416770-19416792 TAGGAAACAGCAGTTTTAGGAGG + Intergenic
927508530 2:23629926-23629948 CAGCGAACAGCACCGGGAGGAGG + Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931190722 2:59997610-59997632 CAGCAAGGAGAAGTGGTGGGAGG + Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933039389 2:77443364-77443386 CAGCAAAAAGCAGTGGCACCAGG + Intronic
933081175 2:77988528-77988550 CAACAAGCAGCAATGGTAGCTGG + Intergenic
933450462 2:82443281-82443303 CAACAAACAACAGTACTAGGAGG + Intergenic
934680933 2:96283527-96283549 CATCCAACGGCAGAGGTAGGTGG - Exonic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
936428084 2:112436235-112436257 GAACAAACAGCAGGGGTGGGGGG - Intergenic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937465748 2:122131676-122131698 CAGCCCACAGCAGTGGCAGTGGG + Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937862646 2:126723000-126723022 CAGCAGACAGCAGTGGCAGAGGG + Intergenic
938993854 2:136657028-136657050 TAGCAAACACAAGTGGTAAGAGG - Intergenic
939022651 2:136977613-136977635 CAGCCAAAAGCAGTGTTAAGAGG - Intronic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941918775 2:170829051-170829073 GAGAGAACAGCAGAGGTAGGAGG - Intronic
942057752 2:172200382-172200404 CAGAATCCAGCAGTGGTATGTGG - Intergenic
942265306 2:174218750-174218772 CAGCAAACCCCAGGGGTGGGAGG + Intronic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
946025447 2:216669248-216669270 CAGCAAACAGGAGGAGGAGGAGG + Intergenic
946089233 2:217206171-217206193 CACCAAACACCAGGGGCAGGGGG + Intergenic
947584228 2:231342693-231342715 AAGCAGACAGCAGTGTTAAGTGG + Intronic
947959522 2:234223410-234223432 CAGCACACAGCAGCTGCAGGAGG + Intergenic
948174276 2:235930909-235930931 CGGCCATCAGCAGTGGTAAGAGG + Exonic
948590440 2:239046444-239046466 CCACAAACAGGAGTGTTAGGAGG - Intergenic
948725854 2:239933453-239933475 CAGCCTACAGCAGTGGTGGCAGG - Intronic
1170136492 20:13079893-13079915 GGGCAAACAGCTGTGGCAGGTGG - Intronic
1170341071 20:15327715-15327737 GAGAAAACAGCAGAAGTAGGGGG - Intronic
1170467689 20:16637877-16637899 CAGCAGACAGCTGTGGGATGTGG + Intergenic
1170730480 20:18970624-18970646 CAGAACAGAGCAGTGGCAGGAGG - Intergenic
1171019856 20:21575342-21575364 CAGATAACAGCAGTTGAAGGTGG - Intergenic
1171448362 20:25220205-25220227 CAGCAAACAGCAGTCGCGGCTGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172781662 20:37440101-37440123 AAGCAAACAGCAGAGGTGGCAGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173539684 20:43842268-43842290 CTGCAGACAGCAGGGGTAGATGG - Intergenic
1175735789 20:61386167-61386189 CAACGAACAGCAGTGGTACGTGG - Intronic
1175758742 20:61546966-61546988 AAGCAGACAGCAGTGATGGGCGG + Intronic
1176374169 21:6078976-6078998 GAACAAACAGCAGGGGTGGGAGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177738119 21:25118775-25118797 CGGGGAACAGCAGTGGTAGAGGG - Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179408455 21:41143989-41144011 CAGCAACCACCAGAGTTAGGAGG - Intergenic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1179749308 21:43459269-43459291 GAACAAACAGCAGGGGTGGGAGG - Intergenic
1179823551 21:43951398-43951420 CAGCAGACAGCAGTTGGCGGAGG - Intronic
1180107364 21:45629007-45629029 CAGGAAACAGGAGTGGGAAGAGG + Intergenic
1180839421 22:18952217-18952239 CAGCAACCTGCAGGGGTGGGTGG + Intergenic
1180953480 22:19731150-19731172 GAGCAAACACCAGCGGGAGGGGG - Intergenic
1180969231 22:19806422-19806444 CAGCCAGCAGCAGTGGCAGCAGG - Intronic
1181062479 22:20288267-20288289 CAGCAACCTGCAGGGGTGGGTGG - Intergenic
1184072506 22:42154769-42154791 CAGCAAACATGGGTGGTGGGTGG - Intergenic
1184178124 22:42801399-42801421 CAGCAAACATCAGTTGTGGGTGG - Intronic
1184379707 22:44137687-44137709 CACCAACCACCAGAGGTAGGGGG - Intronic
1184521403 22:44996334-44996356 CACCAACCAGCAGTTGTACGGGG - Intronic
1185006109 22:48277919-48277941 CAGCAACCTCCAGTGGCAGGAGG - Intergenic
1185372259 22:50466360-50466382 GAGGAAACAGCAGTGCCAGGAGG + Exonic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
950060210 3:10064801-10064823 GAGAAAACAGCAGCGGCAGGAGG - Exonic
950301577 3:11884024-11884046 GAGAAAACAGCAGCGGCAGGAGG - Intergenic
950708731 3:14800356-14800378 GGGCAAACAAGAGTGGTAGGAGG + Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951951876 3:28207977-28207999 CATCAAATAGGATTGGTAGGTGG + Intergenic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
952997061 3:38894753-38894775 CAGCAAAAAGAGGTGGCAGGAGG - Exonic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956100130 3:65759568-65759590 CAGCCAGCAGCAGTGGGTGGGGG + Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957252534 3:77792232-77792254 CAGCAAAGACCTGTGGAAGGTGG + Intergenic
957557721 3:81782297-81782319 CAGCAAACAACAATGGTGGATGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960995160 3:123335822-123335844 GGGGAAACAGCAGTGGTTGGGGG - Intronic
961360130 3:126361786-126361808 CAACAAACAGAACTGGTAGGTGG - Intergenic
962154754 3:132934494-132934516 GTGCAAGCAGCAGTGGTAGGTGG - Intergenic
962282993 3:134066236-134066258 CTGCATACAGCTGGGGTAGGAGG - Intronic
962487786 3:135861939-135861961 CAGTAAACTGCAGAGGAAGGGGG + Intergenic
962851385 3:139310807-139310829 CAGGAAACAGAACTGGGAGGCGG + Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963315967 3:143759182-143759204 CAGGAAATAGCAGTGTTAGATGG - Intronic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
963915312 3:150854370-150854392 CAGCAAACAGCAGTAGCAGACGG - Intergenic
965113041 3:164451556-164451578 CAACAAATAGCAGGGGTGGGTGG + Intergenic
965116369 3:164494901-164494923 CAGCAAACAGCAAGGGTAAAAGG - Intergenic
966218802 3:177530302-177530324 CAGCAAAAAGCAGTGTCATGTGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969397479 4:6931961-6931983 CAGCAAGCAGAGGTGGTACGAGG + Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
971170469 4:24228098-24228120 CAGCAAGCACCAGTGGGATGGGG + Intergenic
971727074 4:30327795-30327817 CAGCAAAGAGCAGTGGGTCGTGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
976994360 4:91411979-91412001 CAGCAAGAAGCAGGGTTAGGAGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979450603 4:120866091-120866113 TGGCAAACAGCATTGGTATGAGG - Intronic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
981667713 4:147248337-147248359 GAGCAAACAGAAGTGGATGGAGG - Intergenic
982406593 4:155027305-155027327 CAGCAAAAGGCAGTGGGTGGCGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
983920947 4:173343941-173343963 CAGGAAACACCAGTAGGAGGTGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
985120018 4:186631052-186631074 CAGCCTCCAGCAGAGGTAGGCGG - Intronic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
987923646 5:24314226-24314248 CAGCCAGCAGCTGTGCTAGGAGG + Intergenic
988530239 5:32021229-32021251 AAGCAAACAGTAACGGTAGGGGG - Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990229055 5:53690434-53690456 CAGCAAAAAGCAGTTCTAAGAGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992311162 5:75500134-75500156 CAGCAAACACCAGATGTAAGGGG + Intronic
992667124 5:79021454-79021476 AAGCCAACAGCAGGGGAAGGAGG + Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995187265 5:109285033-109285055 CAGCAAAAAGCAGTGCTAGAAGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
996551005 5:124730132-124730154 CAGCACACACCAGTAGTAGGAGG - Intronic
996901856 5:128551894-128551916 CAGAGAACACCAGTGGGAGGTGG - Intronic
997472427 5:134124382-134124404 CAGCAGAAAGCAGGGGAAGGGGG - Intronic
998055041 5:139067487-139067509 CATCAAGCAGAAGTGGTTGGTGG + Intronic
998290662 5:140911034-140911056 AAGCAAACAGGGGTGGTGGGGGG + Intronic
998704833 5:144746678-144746700 CAACAAGAAGCAGTGGTAAGTGG - Intergenic
1000786294 5:165548581-165548603 CTGGAAACAGGAGTGGAAGGTGG + Intergenic
1001025638 5:168222240-168222262 CAGCAGGCAGCACTGGGAGGTGG - Intronic
1001447191 5:171794675-171794697 ATGCAATCAGCAGTGGCAGGAGG + Intergenic
1001555037 5:172631342-172631364 AAGCAAACAGGAGTGGCAGGGGG + Intergenic
1001857492 5:175025576-175025598 AAGCAACCAGCACTGGGAGGTGG - Intergenic
1002307506 5:178292490-178292512 CAGCAAGAAACAGTGGGAGGTGG + Intronic
1003023395 6:2531270-2531292 CAGCAAAAAGCAGAGAAAGGAGG - Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1007966487 6:46008185-46008207 AAGCCAACAACAGTGGCAGGAGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1010305709 6:74319409-74319431 CAGAAAACATCCTTGGTAGGGGG + Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012666871 6:101982158-101982180 CAGCAAATAGAATTGGTGGGTGG + Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1019843777 7:3476279-3476301 CAGCAAACAGCTGTGGGTGATGG - Intronic
1020510162 7:9046488-9046510 CAGGTCACAGCAGTGGAAGGAGG - Intergenic
1020685502 7:11288861-11288883 CTGCAAACAGCAGCAGTAGATGG - Intergenic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023466978 7:40466729-40466751 CAGAAAAGAGCAGTGGTAGCTGG + Intronic
1023665378 7:42517722-42517744 CAACAAAGAGGAGTGGTAGATGG + Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1027001329 7:74656910-74656932 AAGCAAAAAATAGTGGTAGGGGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028384316 7:90237201-90237223 CAGGAAAAAGCAGTGGAAGTAGG - Exonic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028811611 7:95094426-95094448 CAGGAAACAGCACTGGAAGACGG - Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032976524 7:137230499-137230521 CAGTAAAAAGTAGTGGAAGGAGG + Intronic
1033311746 7:140266764-140266786 GGGCGAACAGCAGTGGGAGGGGG - Intergenic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034950084 7:155291094-155291116 CAGCAGATAGCAGTGGCAGAGGG - Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1036137884 8:6179073-6179095 CAGCAAACAGAAGGGGTTGAAGG - Intergenic
1036247872 8:7135555-7135577 CAGAAAAAAGCAGTACTAGGAGG - Intergenic
1037115319 8:15218591-15218613 CAAGAAACAGTATTGGTAGGTGG - Intronic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037915463 8:22770252-22770274 CAGTCAACAGCTGTGGGAGGTGG + Intronic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1040444331 8:47478241-47478263 AAGCAAAAAGCAGTGAGAGGAGG + Intronic
1041766822 8:61427474-61427496 CAGTAAACAGCAGTTGTATAGGG + Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043488671 8:80725168-80725190 CAGCAAAGTACTGTGGTAGGAGG + Intronic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045500130 8:102738503-102738525 CAGTAAACTGCAATGGGAGGTGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047490061 8:125366922-125366944 CAACAGACAGCTGGGGTAGGAGG - Exonic
1048183260 8:132215625-132215647 CAACAAACAGCAGTGGGTGCAGG - Intronic
1048264877 8:132976857-132976879 CATCAAACAGAAGTGGGTGGTGG + Intronic
1048496452 8:134939859-134939881 AAGTAAACAGCAGTGGAGGGAGG + Intergenic
1048567290 8:135614971-135614993 GAGGAAACATCAGTGGTAGGGGG + Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1050593498 9:7183541-7183563 TAGCAAACAGCAATGGTAGACGG - Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051894031 9:21970127-21970149 CAGCAGACAGCTGTGGGAGTAGG + Intronic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1054841387 9:69744901-69744923 CAGCACAGAGGAGTGGTAAGAGG + Intronic
1055696814 9:78893864-78893886 CAGCAAACAGCAGAGATAACTGG + Intergenic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1058220696 9:102297092-102297114 CAACATACAACAGTGGTAAGAGG + Intergenic
1060091597 9:120748045-120748067 AAACAACCAGCAGTGATAGGAGG - Intergenic
1062154012 9:135036133-135036155 AAGCAAACACCAGGGGCAGGGGG + Intergenic
1186129018 X:6446347-6446369 GAGCAAACAGAAGGGGAAGGGGG - Intergenic
1186772215 X:12829342-12829364 AAGGAAACATCAGGGGTAGGAGG - Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189707570 X:43774127-43774149 CAGCAAACAGAGGGGGTAAGTGG - Intronic
1189875207 X:45429308-45429330 CACCAAACAGGAGTGTGAGGTGG + Intergenic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1190344077 X:49321886-49321908 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190345171 X:49331431-49331453 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190346265 X:49340997-49341019 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190347517 X:49532026-49532048 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190348618 X:49541582-49541604 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190349719 X:49551138-49551160 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190350823 X:49560691-49560713 TAGGAAACAGCAGAGGGAGGTGG + Intronic
1190351924 X:49570249-49570271 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190353025 X:49579798-49579820 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190354126 X:49589345-49589367 TAGGAAACAGCAGAGGGAGGTGG + Intergenic
1190355228 X:49598869-49598891 TAGGAAACAGCAGAGGGAGGTGG + Intronic
1190998555 X:55636389-55636411 GAGGAAAGAGCAGGGGTAGGGGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192065415 X:67879908-67879930 CAATAAGCAGCAGTGGTAGATGG + Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1194437829 X:93891083-93891105 CAGCAAAAAGCAGTACTAAGAGG - Intergenic
1194888427 X:99348082-99348104 CTGAAAGCAGCAGGGGTAGGTGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195378863 X:104253194-104253216 CAGAAAACTGCACTGGGAGGTGG - Intronic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1196986802 X:121282390-121282412 CAGCACACAGCAGTGCCAGTGGG + Intergenic
1197594752 X:128451592-128451614 CAGGTGTCAGCAGTGGTAGGTGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199317481 X:146397487-146397509 CAGCAAAAAGCAGTGCTAAGAGG - Intergenic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic