ID: 1095552956

View in Genome Browser
Species Human (GRCh38)
Location 12:43466076-43466098
Sequence CAGAGAAACCTGAAGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 552
Summary {0: 1, 1: 1, 2: 6, 3: 43, 4: 501}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095552952_1095552956 3 Left 1095552952 12:43466050-43466072 CCATTTGGATAAAAGAAATTGGG 0: 1
1: 0
2: 0
3: 20
4: 298
Right 1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG 0: 1
1: 1
2: 6
3: 43
4: 501

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095552956 Original CRISPR CAGAGAAACCTGAAGGAAGG TGG Intronic
901375256 1:8833623-8833645 CAGAAATACATGAAGAAAGGAGG + Intergenic
901395921 1:8981449-8981471 CTGAGAAAGCAGGAGGAAGGAGG - Intergenic
901598208 1:10401629-10401651 CAGAGAAAACTGAAAAATGGTGG + Intronic
901600033 1:10416484-10416506 CACAGCAACCAGAAGAAAGGTGG - Intronic
901832868 1:11904280-11904302 CAGAGAAACCTGATGATAGAAGG + Intergenic
903799460 1:25955717-25955739 AAGAGAAAAAGGAAGGAAGGAGG + Intergenic
903812681 1:26043611-26043633 GGGAGGATCCTGAAGGAAGGGGG - Intronic
904696537 1:32334847-32334869 AAGAGAAATCGGAAGGAGGGTGG - Exonic
905120664 1:35679428-35679450 CAGAGAAGCCAGGAGGAGGGAGG - Intergenic
905247875 1:36627276-36627298 CAGACAGACTTGAAGGATGGAGG - Intergenic
905389686 1:37628480-37628502 CAGGGAAACATGAAGCAAGAGGG + Intronic
905573042 1:39021223-39021245 CAGAGAGAATGGAAGGAAGGAGG - Intergenic
905728493 1:40276367-40276389 CAGAGAAACAGCCAGGAAGGAGG + Intronic
906066984 1:42988029-42988051 CAGTGAAACGGGATGGAAGGAGG - Intergenic
906096505 1:43227822-43227844 GAGGGAAAACTGGAGGAAGGGGG - Intronic
907707416 1:56844871-56844893 TAGAAAAACCTTAAGGCAGGAGG - Intergenic
908229204 1:62087128-62087150 CACAGACACTTGAAGGATGGTGG + Intronic
909288630 1:73853991-73854013 AGGAGGAACCTGAAGGAAGCTGG - Intergenic
910048305 1:82944506-82944528 CAAACAAAACTGGAGGAAGGTGG + Intergenic
910505255 1:87943195-87943217 CAGTGAAACCTAAAGGATGAGGG + Intergenic
910527813 1:88201251-88201273 CATAGAAAACTGAAGTAGGGAGG + Intergenic
910724527 1:90324538-90324560 CAGAGAACTCTGCAGGAAGGGGG + Intergenic
911117476 1:94260729-94260751 CAAAGAAAAATGAAGGAAGTTGG + Intronic
911144377 1:94538583-94538605 CAGAGCCACCTGAGGGATGGTGG + Intronic
911257460 1:95648399-95648421 TAGAGAAACCTCTAGGAAAGAGG + Intergenic
911685247 1:100768343-100768365 TATTGAAACCTGAAAGAAGGAGG + Intergenic
911882621 1:103261019-103261041 CACAGAAACCTTAAGGAATTGGG + Intergenic
911883973 1:103273851-103273873 AACAGAAACCTAAAGGAAAGAGG + Intergenic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
913088514 1:115460204-115460226 CAGAGATGCCAGAAGGAAGTGGG - Intergenic
913256229 1:116956549-116956571 CAGAGCAGCAGGAAGGAAGGCGG + Intronic
914974198 1:152344041-152344063 CAGAGAAATCTTAAGGAAAGAGG - Intergenic
915841574 1:159217358-159217380 CACAGAGGCCTGAGGGAAGGTGG - Intergenic
915865182 1:159491860-159491882 CAGATAAACCAGAAGACAGGTGG - Intergenic
916277800 1:163013957-163013979 CTGAGAGACCTGAATGAAGATGG - Intergenic
917083321 1:171279563-171279585 TTGAGAAGCCTGAAGGTAGGAGG - Intronic
917603540 1:176602223-176602245 CAGTGAAACCTCAGGGAATGAGG - Intronic
917608537 1:176661806-176661828 AAGACAGACCAGAAGGAAGGTGG + Intronic
918643719 1:186876857-186876879 GAGATAAAGCTGAAGGAAAGAGG - Intronic
919423258 1:197398426-197398448 AAGGCAAAACTGAAGGAAGGCGG + Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
921035590 1:211375529-211375551 AAGAGAAACACCAAGGAAGGTGG + Intergenic
921254846 1:213329940-213329962 CAAAGAAACCTGAAGTGAGAAGG + Intergenic
921740810 1:218682303-218682325 CAGAGATGCCACAAGGAAGGAGG + Intergenic
922190735 1:223316448-223316470 CATGGGAACCTGGAGGAAGGGGG + Intronic
924224279 1:241908060-241908082 CAGAGAAACCTGAAGAACACTGG + Intergenic
924867397 1:247999612-247999634 TGGAGGAACTTGAAGGAAGGAGG + Intronic
924868643 1:248015286-248015308 TGGAGGAACTTGAAGGAAGGAGG + Intronic
924871289 1:248048417-248048439 TGGAGGAACTTGAAGGAAGGAGG + Intronic
1062933870 10:1371117-1371139 CAGAGAACCCGGAAAGAAAGTGG + Intronic
1063520404 10:6735833-6735855 CAGATAAGCCAGAAGCAAGGTGG - Intergenic
1065146596 10:22775050-22775072 CAAATAAACCTGAAGGAAGCAGG - Intergenic
1065498018 10:26349894-26349916 CAGAAAAATCTCAAGGAAAGGGG + Intergenic
1065564030 10:26991123-26991145 CAGGGATCCCTGGAGGAAGGAGG + Intergenic
1068546136 10:58347547-58347569 CAGAGAAAACTGGGGGAAAGTGG + Intronic
1068788030 10:60998606-60998628 AAGAAAAACGGGAAGGAAGGGGG + Intronic
1069931780 10:71887777-71887799 CAGAGAAATTTGCATGAAGGAGG + Intergenic
1070260949 10:74855207-74855229 CAGTGAGGCCTGCAGGAAGGAGG + Intronic
1070314442 10:75296501-75296523 ATGAGAAGCCTGGAGGAAGGGGG - Intergenic
1070402776 10:76067977-76067999 CAGGGAAACCTGCAAGAAGGGGG + Intronic
1070759753 10:79016691-79016713 AGGAGAGACCAGAAGGAAGGAGG + Intergenic
1070843663 10:79505283-79505305 AAGAGAAAGCTGAAGCAGGGAGG - Intergenic
1070930003 10:80254317-80254339 AAGAGAAAGCTGAAGCAGGGAGG + Intergenic
1071808832 10:89155602-89155624 CTGAGAAACAGGAAGGAAGAGGG + Intergenic
1072791783 10:98323143-98323165 CAGAGAGACATGAAGAAATGGGG - Intergenic
1073223761 10:101898539-101898561 CTGAGATACCTGAAGGAAGCAGG + Intronic
1073918167 10:108429873-108429895 CAGAAAAACGTGAAGCAAGGAGG - Intergenic
1075159835 10:120013366-120013388 CAGGTTAAACTGAAGGAAGGTGG + Intergenic
1075420679 10:122298283-122298305 CAGAGAGAGCTGAAGTCAGGAGG - Intronic
1076064589 10:127439409-127439431 CAGAGAGACCTGGAGGAAGGTGG + Intronic
1076349592 10:129806953-129806975 AAGAGCAACCTGAATGAAGCAGG - Intergenic
1077931526 11:6737952-6737974 CAGAGAAACCTGCAGGACTGGGG + Intergenic
1079030303 11:16981686-16981708 AAGAGAAAAATGAAGGAATGAGG + Intronic
1079093735 11:17497787-17497809 CAGAGAACCCAGGATGAAGGAGG - Intronic
1079399977 11:20098975-20098997 CTTAGGAACCTGAAGGAAAGAGG + Intronic
1079547244 11:21647464-21647486 CAGTGAATCCTGAGGGGAGGTGG - Intergenic
1079613179 11:22458161-22458183 CAGAAAGAAGTGAAGGAAGGAGG - Intergenic
1079659501 11:23021006-23021028 CAGACAACCCAGAAGGAAGAAGG - Intergenic
1079874979 11:25845182-25845204 CAGGGAAACTTGAGTGAAGGAGG - Intergenic
1080154932 11:29098625-29098647 CTGAGCAACCTGAAGGAAGCTGG - Intergenic
1080604397 11:33852826-33852848 CACAGATACTTGAAGGATGGTGG + Intergenic
1082929137 11:58580545-58580567 CAGAGAAAATTGAAGTGAGGGGG + Intronic
1083995461 11:66269401-66269423 CAGAGAATCCCACAGGAAGGGGG - Intronic
1084090235 11:66874943-66874965 CAGAGAAAGCTCCAGGAAGAAGG + Intronic
1084381625 11:68816547-68816569 CCAAGGAGCCTGAAGGAAGGCGG - Intronic
1084662523 11:70554551-70554573 CAGAGGAACCTGGGGGAGGGGGG - Intronic
1085432978 11:76471947-76471969 AACAGAAACCAGAAGGAAGTAGG - Intronic
1086070745 11:82796322-82796344 CACAGTAACGAGAAGGAAGGAGG - Intergenic
1086260809 11:84937898-84937920 CAGAGAAACTTAGAGGTAGGAGG + Intronic
1087242921 11:95800321-95800343 AAGGGAAACATGAAGGAAGGAGG - Intronic
1088368767 11:109066338-109066360 CTGAGAAATCTGAAGCAAAGAGG + Intergenic
1088752315 11:112854655-112854677 AAAAGAAACCTGGAGGGAGGAGG + Intergenic
1088814209 11:113410403-113410425 CAGAGGAAGGTCAAGGAAGGCGG + Exonic
1088889547 11:114033736-114033758 CAGAGTAACCTGAAGGACTCAGG - Intergenic
1089108017 11:116031456-116031478 GAGACCAATCTGAAGGAAGGTGG - Intergenic
1090349802 11:126100787-126100809 CAGAGACACCAGGAGGGAGGGGG + Intergenic
1090880410 11:130827721-130827743 CAGAGAAACAGGCAGGAAGCAGG - Intergenic
1091076423 11:132622306-132622328 CAAAGACAACTGAAGAAAGGGGG + Intronic
1091391949 12:131134-131156 CACAGCAACCTGAAAGAAGGGGG + Intronic
1091461578 12:647150-647172 CACAGACACCTGAGGGATGGGGG - Intronic
1092225492 12:6745622-6745644 CAGAGAACCCTGAAGGAGCAAGG + Intergenic
1093146252 12:15570233-15570255 TATAGAAACCTGAAGGATGGGGG - Intronic
1093669302 12:21853760-21853782 CAAAGTGACCTGAAGGGAGGAGG + Intronic
1093905753 12:24690210-24690232 CAGATCAAACTGAAGGAAAGAGG + Intergenic
1095366398 12:41411399-41411421 CAGAGAAACCTAAGGGGAGGTGG - Intronic
1095524301 12:43106779-43106801 CGGAGAAAGCTTAATGAAGGAGG - Intergenic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1095882272 12:47150617-47150639 AACAGAAGCCTGAAGGAAGTGGG + Intronic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097571089 12:61333616-61333638 CAGAGAAGCCTGAAGGAGCGAGG + Intergenic
1097872212 12:64610809-64610831 CAGAGACACGTGGAGGCAGGGGG - Intronic
1098214281 12:68199378-68199400 CAGAGAGACCTGAAGGAAATGGG + Intergenic
1098460769 12:70730842-70730864 GAGAGAGAGCAGAAGGAAGGAGG + Intronic
1099305657 12:80951825-80951847 CATAAAGACCTGAGGGAAGGGGG - Intronic
1099886893 12:88542475-88542497 CAGAGCATCTTGAAGGAAGTCGG - Intronic
1099930511 12:89068787-89068809 AAGAACAACATGAAGGAAGGGGG + Intergenic
1099972658 12:89515926-89515948 CAGGGGAATTTGAAGGAAGGAGG - Intronic
1100251088 12:92824638-92824660 ATGAAAGACCTGAAGGAAGGAGG - Intronic
1100759583 12:97792493-97792515 AAGAGAATTCTGAAGGAAGTTGG - Intergenic
1101585748 12:106084063-106084085 GAGAGCAGCCTGAAGGATGGAGG - Intronic
1101752467 12:107593761-107593783 CAGAGCAACAAGAGGGAAGGTGG - Intronic
1101983205 12:109425617-109425639 CAAAGAAACACAAAGGAAGGTGG + Intronic
1102099744 12:110269337-110269359 CAGATAAAAAGGAAGGAAGGAGG - Intergenic
1102541453 12:113622380-113622402 CGAAGAGAGCTGAAGGAAGGGGG - Intergenic
1103013647 12:117477181-117477203 CAGAGAAGCCTTGAGGATGGAGG - Intronic
1105867688 13:24475047-24475069 CATACAGACCTGAAGGAAGTGGG - Intronic
1106090661 13:26590397-26590419 AAAAGAAACCCGAAAGAAGGTGG + Intronic
1106453765 13:29909208-29909230 CAGAAAACCCCCAAGGAAGGAGG - Intergenic
1106722360 13:32448651-32448673 CAGATAAAGCTGAAGAAAGCAGG + Intronic
1107037058 13:35912657-35912679 CACAGATACTTGAAGGATGGTGG - Intronic
1107135393 13:36938677-36938699 CATCAACACCTGAAGGAAGGAGG - Intergenic
1108093425 13:46875550-46875572 CTGAGAAACATGAAGTATGGTGG - Intronic
1108195592 13:47991415-47991437 AAGAGAAACTTGAAGGATCGGGG - Intronic
1108209533 13:48124405-48124427 CAGAGGAATCAGAAGAAAGGTGG - Intergenic
1109305821 13:60640480-60640502 CAGAGACAACTGAATGAAGCTGG - Intergenic
1111055719 13:82947269-82947291 CTGAAAAACCTCAAGGAATGAGG - Intergenic
1111641254 13:90973414-90973436 TTGAGAAACTTGGAGGAAGGAGG + Intergenic
1111920361 13:94403406-94403428 CACAGATAGCTGAAGGAAAGAGG - Exonic
1112197377 13:97238933-97238955 TAGATAAATGTGAAGGAAGGTGG + Intronic
1112908133 13:104449022-104449044 CAGTGAAACAAGAAGGCAGGTGG - Intergenic
1114261449 14:21039526-21039548 CAGAAAAAGATGGAGGAAGGGGG - Intronic
1114904492 14:27109331-27109353 AAGAGGAACCTGAAGGGAGGTGG + Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115964204 14:38868693-38868715 CTGAGAAAGCTCAAGAAAGGGGG + Intergenic
1116088803 14:40277560-40277582 CACAGAAACCTAAAGTTAGGGGG - Intergenic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117697896 14:58384738-58384760 AAGAAATACCTGAAGGTAGGGGG + Intergenic
1119893027 14:78197332-78197354 CAGAGAAGCAAGAAGGAGGGAGG - Intergenic
1120554981 14:85918632-85918654 AAGAGAAAGCGGAAGGATGGAGG + Intergenic
1120679129 14:87458383-87458405 CAGATAAACCTGGAGTGAGGTGG + Intergenic
1121530005 14:94645633-94645655 CAGAGAAACCTTCATGGAGGAGG - Intergenic
1121705460 14:95989970-95989992 CAGTGACACCTGAAGTGAGGAGG + Intergenic
1121876263 14:97456366-97456388 GAGACAAACCAGAAGGAATGGGG - Intergenic
1121911740 14:97798025-97798047 CACAGAAAACTGAAGTAGGGGGG - Intergenic
1122313811 14:100813891-100813913 CAGAGAACCCCAAAGGAAGCTGG - Intergenic
1122530020 14:102418929-102418951 CAGAGAATCCTGGAGGCACGGGG + Intronic
1122955654 14:105069722-105069744 CAGACACACCTGATGGAGGGGGG - Intergenic
1122955673 14:105069792-105069814 CAGACACACCTGATGGAGGGAGG - Intergenic
1123133496 14:106007029-106007051 CAGAGGCACATCAAGGAAGGGGG + Intergenic
1123135881 14:106027002-106027024 CAGAGGCACATCAAGGAAGGGGG + Intergenic
1123165239 14:106319707-106319729 CAGAGGCACATCAAGGAAGGGGG + Intergenic
1123583517 15:21737475-21737497 CAGAGGCACATCAAGGAAGGGGG + Intergenic
1123620167 15:22180078-22180100 CAGAGGCACATCAAGGAAGGGGG + Intergenic
1124175245 15:27418142-27418164 CAGATGAATATGAAGGAAGGAGG + Intronic
1124380522 15:29161215-29161237 CCAAGAAACCTTGAGGAAGGAGG + Intronic
1124883421 15:33662330-33662352 CATAGAAACCAGATCGAAGGAGG - Exonic
1124889262 15:33716995-33717017 CATAGAAACCTGAAGTCAGAAGG - Intronic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1128119254 15:65133602-65133624 CAGCGGAGGCTGAAGGAAGGGGG + Exonic
1128285004 15:66429567-66429589 TAGAGTAACCTGAAGGATTGAGG + Intronic
1128596670 15:68957991-68958013 CAGAGAAGAATCAAGGAAGGAGG + Intronic
1129107987 15:73322415-73322437 CAGTTAAACCTGAAGGAAGAAGG + Exonic
1129179068 15:73860201-73860223 CAGATAAACTTGAAGGAAGCAGG + Intergenic
1129332938 15:74837058-74837080 CAGAGTAACCTGAGGGAGGCTGG + Exonic
1130103168 15:80909314-80909336 CAGAGTTCCCTGAGGGAAGGAGG - Intronic
1130983296 15:88827724-88827746 CAGACAAACCTTGAGAAAGGAGG + Intronic
1131310812 15:91288168-91288190 AAGGGAAACCTGAAGAAAGGCGG - Intronic
1131362607 15:91806452-91806474 CAGAGAAGAATGAAGGAAGCTGG + Intergenic
1132095331 15:98980288-98980310 CAGAGAAACCTGAACGATCAGGG + Intronic
1132544851 16:528261-528283 CAGAGGAACCCAGAGGAAGGCGG + Intronic
1133480548 16:6166483-6166505 CAGAGATATGTGATGGAAGGAGG - Intronic
1133839830 16:9397634-9397656 TAGAGAAACAGGAAGGAAGATGG - Intergenic
1133873242 16:9709265-9709287 CTGAGAACCCAGAAGGCAGGAGG - Intergenic
1133942528 16:10322286-10322308 GAAAGAAACTTGAAAGAAGGGGG + Intergenic
1134225310 16:12385488-12385510 CAGGGAGAAGTGAAGGAAGGAGG + Intronic
1134372983 16:13642960-13642982 CAGAGAAGTCTCAAGGTAGGAGG + Intergenic
1135081110 16:19436709-19436731 CAGCCAAACCTGAAGGCAGCTGG - Intronic
1135391635 16:22098559-22098581 CAGATGAACCTGAAGGAAAGAGG + Intronic
1135686719 16:24503702-24503724 CAGAGATAAATGAAGGAGGGAGG + Intergenic
1136413277 16:30089311-30089333 CAGAGAAACATCAAAGGAGGTGG + Intronic
1138621170 16:58212542-58212564 GAGAGAAGGATGAAGGAAGGAGG + Intergenic
1139598317 16:67970618-67970640 CTGAGAAATCTGAGGGGAGGTGG - Intergenic
1140748766 16:78004472-78004494 CAGATAAATCTGAAAGAGGGTGG + Intergenic
1141711109 16:85699396-85699418 CTGAGAAGCCAGAAGGAAGGGGG + Intronic
1141766870 16:86064610-86064632 GAGGGAAACCTGAAGGAGGGGGG - Intergenic
1141815157 16:86404708-86404730 CAGGAAGACCTGAGGGAAGGCGG - Intergenic
1143105142 17:4525980-4526002 TAGAGAAAGATGAAGGAAGAAGG + Intronic
1143433572 17:6905358-6905380 CAGAGAACCATTAAGGAAAGTGG - Intronic
1143775773 17:9197927-9197949 CAGAGAAGCCTCCAAGAAGGTGG + Intronic
1144023214 17:11255316-11255338 AAGAGAAAAATGAAGGGAGGAGG + Intronic
1144480684 17:15626715-15626737 CTGAGAACCATAAAGGAAGGTGG + Intronic
1144917624 17:18737026-18737048 CTGAGAACCATAAAGGAAGGTGG - Intergenic
1145305607 17:21673372-21673394 CAGAGCGACCTGAAAGAAGATGG - Intergenic
1145846766 17:28045209-28045231 AAGACAAACCTGAAGTAAGATGG - Intronic
1146660252 17:34660781-34660803 AAGAGAAGCCAGAAGGAATGGGG + Intergenic
1147035748 17:37679123-37679145 CAGAGAAACGTGAAAGAGGAGGG - Intergenic
1148676065 17:49445747-49445769 CAGAGAAGGATGAAGGGAGGAGG + Intronic
1148758703 17:49988084-49988106 CAGAGAGAGAGGAAGGAAGGAGG - Intergenic
1149014013 17:51887377-51887399 CAATCAAACCTGAAGGCAGGCGG + Intronic
1149282424 17:55122500-55122522 CAGAGATAAATGAAGGAATGTGG + Intronic
1149515207 17:57275923-57275945 CACAGAGAACTGAAGGAGGGAGG - Intronic
1150145460 17:62765460-62765482 GAGAGAAGCCTGTAGGCAGGAGG - Intronic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1150604778 17:66681428-66681450 CAGAGAGAACTGAATGAAAGTGG + Intronic
1151947954 17:77329730-77329752 GGAAGAAACCTGAAGGATGGTGG - Intronic
1152889542 17:82872752-82872774 CAGTGAAACCAGAATGACGGTGG - Intronic
1154350299 18:13577535-13577557 CAGAGAAAACTTAAGAAATGGGG + Intronic
1155384689 18:25264835-25264857 CAGAAAAAGCTTCAGGAAGGAGG + Intronic
1157517997 18:48324591-48324613 CAGAGAAACCAAAAGGGAAGAGG + Intronic
1158179985 18:54703427-54703449 GAGAGAAACATGAAGAAAGCAGG - Intergenic
1159577741 18:70200468-70200490 GAGAGACATCTGAAGGGAGGGGG - Intronic
1159798597 18:72869694-72869716 GAGAGAAAGCTGAGAGAAGGGGG + Intergenic
1161585272 19:5102341-5102363 CAGAGGCAACTGCAGGAAGGAGG - Intronic
1161940823 19:7402665-7402687 AAGAGAACCCTAAAGGAAAGGGG + Intronic
1162718872 19:12649995-12650017 CAGCGACACCTGGGGGAAGGAGG - Exonic
1162779528 19:12999762-12999784 GAGAGAAAGCTGGGGGAAGGGGG - Intronic
1163973087 19:20819458-20819480 CAGAGGAGAATGAAGGAAGGAGG + Intronic
1164801824 19:31083423-31083445 CAGAGAACCCTAAAGAAAGCTGG - Intergenic
1164891511 19:31827588-31827610 TAGAGAAACCGGAGGGGAGGAGG - Intergenic
1164973286 19:32550611-32550633 CAGAACCACCTGAAGGCAGGCGG - Intergenic
1164982456 19:32624555-32624577 GAGAGAAGCCAGAAGGAGGGCGG + Intronic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1166012142 19:39950397-39950419 CAGAGAAACCTGAATGCGGGGGG - Intergenic
1166209557 19:41297469-41297491 AAGAGACACCTGAAGCAATGTGG - Intronic
1166344195 19:42155182-42155204 CAGAGAAAGATGAAGGCAGCCGG - Intronic
1167194764 19:48020687-48020709 CAGAGGGCCCTGGAGGAAGGAGG - Intronic
1167846076 19:52165582-52165604 CACAGAAACATGAGGGATGGTGG + Intronic
1168559096 19:57368530-57368552 CAGGGGACCCTGAAGGAAGAGGG - Exonic
1168679024 19:58300378-58300400 CAGTGAAGACTGAAAGAAGGGGG + Exonic
925122978 2:1433433-1433455 CATAGAAACCTCAAGAAAAGAGG + Exonic
925416478 2:3673308-3673330 CAGAGAGATCTGGAGCAAGGGGG + Intronic
925880215 2:8345939-8345961 CAGAGATTTCTGAAGGCAGGAGG - Intergenic
925947704 2:8880889-8880911 CACAAAAACCTGAATGCAGGGGG + Intronic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926982464 2:18586069-18586091 CTGAGAAACCTGAAGTACAGAGG - Intronic
927852558 2:26509390-26509412 CCCAGAGACCTGAAGGATGGAGG - Intronic
928529138 2:32172949-32172971 CAGAGAAATAGGAGGGAAGGCGG - Intronic
931392417 2:61855171-61855193 AAGAGCAGCCTGAAGGAAGTGGG - Intergenic
931598563 2:63977933-63977955 CAGGGAAACCTGAAGATAGTAGG - Intronic
931892264 2:66686425-66686447 CAGTGAGACCTGGAAGAAGGGGG - Intergenic
931985401 2:67736733-67736755 CACAGAAACATGAAGTTAGGGGG - Intergenic
932288474 2:70555273-70555295 AAGATCAACCTGAAGGAAGTGGG - Intergenic
933830103 2:86199784-86199806 CAGAGAAACTGGAACGGAGGGGG + Intronic
934512022 2:94953105-94953127 GTGAGAAACCTCGAGGAAGGAGG - Intergenic
934708266 2:96499671-96499693 AAGAGGGGCCTGAAGGAAGGTGG - Intronic
935211866 2:100945541-100945563 ACGAAGAACCTGAAGGAAGGGGG - Intronic
935473182 2:103484168-103484190 CAGAGAAACTTGTAGGAGGTAGG + Intergenic
936013942 2:108943765-108943787 CAGAGCATCCTGGAGAAAGGAGG - Intronic
936460720 2:112712245-112712267 CAGGGATGCCAGAAGGAAGGGGG - Intergenic
937257961 2:120568197-120568219 CAGAGAAGCCAGAGGGGAGGTGG - Intergenic
938416126 2:131105215-131105237 CTGAGAAACGGGACGGAAGGCGG - Exonic
939272815 2:139961578-139961600 CAGAAAAACCTTAAGGAAAGAGG - Intergenic
940101303 2:150042331-150042353 CAGAGAAACCAGAAGAGAAGTGG + Intergenic
940677941 2:156747769-156747791 CAGAGAAACATGAATTAAGACGG - Intergenic
941692364 2:168514296-168514318 CAGAGACACACTAAGGAAGGGGG - Intronic
942462718 2:176179373-176179395 GAGAGAAGGCTGAAGGAAGAGGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944171268 2:196781161-196781183 CAGAAAAACCTGAAGTATAGAGG + Intronic
944856746 2:203775490-203775512 CAGAGCAAGCTGGAGGATGGGGG - Intergenic
946295034 2:218777274-218777296 AAGAGACACCTGAATAAAGGAGG + Intergenic
946764735 2:223030085-223030107 CAGAGAAAGCAGGAGGTAGGGGG + Intergenic
947125180 2:226861274-226861296 CAGAGAAACGGGTTGGAAGGAGG + Intronic
947499388 2:230660866-230660888 CAGAGAATCAGGAAGGAAGCTGG - Intergenic
1169478056 20:5950205-5950227 TGGAGAAACCTGGAGGGAGGGGG + Intronic
1169649696 20:7853349-7853371 CAGACAAACCTGAAGTTGGGAGG + Intergenic
1170271919 20:14537064-14537086 AACAGAAAACAGAAGGAAGGGGG - Intronic
1170273583 20:14556235-14556257 GAGAGAACCCGGAAGGAATGAGG - Intronic
1170436925 20:16339907-16339929 GAGAAAAAAATGAAGGAAGGAGG - Intronic
1170787778 20:19482327-19482349 CAGAGAAGCCTGGGGGAGGGAGG - Intronic
1171057926 20:21926025-21926047 CTGAAAAACCTGAAGTCAGGAGG + Intergenic
1171164290 20:22957010-22957032 CAGTGCTACCTGAAGGTAGGGGG - Intergenic
1171523124 20:25790861-25790883 CAGAGCGACCTGAAAGAAGGTGG - Intronic
1171530864 20:25852839-25852861 CAGAGCGACCTGAAAGAAGGTGG - Intronic
1171553703 20:26065022-26065044 CAGAGCGACCTGAAAGAAGGTGG + Intergenic
1172626338 20:36349602-36349624 CAGAGAAACAGGAAGGAGGCCGG + Intronic
1174199050 20:48794356-48794378 CAGAGAGTCCTGAAGGAAGCTGG + Intronic
1174434295 20:50494620-50494642 CAGCGAGCCGTGAAGGAAGGTGG + Intergenic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1175228945 20:57461394-57461416 AAGAGATGCCTGAACGAAGGTGG + Intergenic
1175709320 20:61206453-61206475 CAGAAGAACAGGAAGGAAGGAGG + Intergenic
1177935265 21:27337538-27337560 CACAGAAACCTGGATGAAGTCGG + Intergenic
1178327339 21:31656645-31656667 AAGAGAAAGAAGAAGGAAGGAGG - Intergenic
1178633002 21:34278871-34278893 CAGAGAAGCTTGCAGGAGGGTGG - Intergenic
1179058000 21:37953854-37953876 CACAGAGAGCTGAAGGAATGTGG + Intronic
1179253644 21:39696719-39696741 CAGAGAAACAAGAAGGGAGGAGG - Intergenic
1179288671 21:39999458-39999480 CAGAGAAAGATGAAGGAAATTGG + Intergenic
1180079494 21:45480308-45480330 CAGAGAAGCCTGAAGGCAGGTGG - Intronic
1180647057 22:17347924-17347946 CAGAGAAAGTTGAAGCAAGCAGG - Intergenic
1181666838 22:24404427-24404449 CAGAGCTCCCTGGAGGAAGGTGG - Intronic
1181849937 22:25742852-25742874 CAGACAGAGCTCAAGGAAGGTGG - Intronic
1182083183 22:27543518-27543540 CAGAGAAACAGGGAGGAGGGAGG - Intergenic
1182167353 22:28189386-28189408 CAAAGAAATCCTAAGGAAGGGGG + Intronic
1182748851 22:32626026-32626048 CAGGAAAAGCTTAAGGAAGGAGG + Intronic
1183023540 22:35046603-35046625 CCCAGAAACCTGGAGAAAGGAGG - Intergenic
1183500847 22:38177921-38177943 AGGAGAAAGCTGAAAGAAGGTGG + Intronic
1183834419 22:40440553-40440575 GACACAAACCTGAAGGAAGAGGG - Intronic
1183919397 22:41152568-41152590 CAGGGAACCCTGAAGAAATGAGG - Intronic
1184003980 22:41695604-41695626 AAGAGAAACCTGAGAGAAGTTGG + Exonic
1184362664 22:44027496-44027518 CAGAGACAGCTGAAGGCAGCGGG + Intronic
1184403265 22:44286118-44286140 CAGGGGCACCTGCAGGAAGGAGG - Intronic
1185016529 22:48346418-48346440 GAGAGAAACCTGCAGGGATGAGG + Intergenic
1185417256 22:50717010-50717032 ATGAGAAAACTGAAGCAAGGAGG + Intergenic
949329059 3:2901205-2901227 CAAAGAAATCTGAATGAAGCAGG + Intronic
949955648 3:9266615-9266637 CAAAAAAACCGGATGGAAGGAGG - Intronic
950672816 3:14537367-14537389 CAGAGGAACATGAAGCAGGGAGG - Intronic
951615312 3:24536379-24536401 AGGAGAAACCTGAAAGAAGCTGG - Intergenic
952553137 3:34501626-34501648 AAAAGTAACCTGAAGGTAGGGGG - Intergenic
952590147 3:34942633-34942655 CAGAGAGAGAGGAAGGAAGGAGG - Intergenic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953200097 3:40770877-40770899 CAGTGAACCCTCAAGGAATGCGG - Intergenic
954111414 3:48435429-48435451 CAGAGAGACCTGGAGGATGTAGG - Intronic
954124193 3:48519067-48519089 CACAGAAACGTGAGGGCAGGGGG - Exonic
954244578 3:49320722-49320744 AAAAGAAACCTGAAATAAGGAGG - Intronic
955399482 3:58581266-58581288 CAGAGGAACCCAAAGGAAGGGGG + Intronic
955419404 3:58721649-58721671 CAGACAAATCTGGAGGGAGGGGG + Intronic
956615940 3:71172726-71172748 CAGTGAATCCAGAAGGAAGAGGG - Intronic
958205758 3:90388448-90388470 CATAAAAACTAGAAGGAAGGAGG - Intergenic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
958822576 3:98992464-98992486 CAGAGGAAACTGAAGGGAGAGGG - Intergenic
959025543 3:101236379-101236401 CATACAAAACTGAAGTAAGGTGG + Intronic
959281379 3:104346064-104346086 CAAAGAAACTTGAAGTGAGGTGG + Intergenic
960071177 3:113433100-113433122 CCCAGAAAGCTGTAGGAAGGTGG - Intronic
960166573 3:114409493-114409515 CAGAAGCAGCTGAAGGAAGGGGG + Intronic
961093840 3:124138145-124138167 AAGAGAAAGCTGCAGGAGGGTGG - Intronic
961339843 3:126210808-126210830 CAGAGAAGCCTGGAGAAAGCAGG - Intergenic
962404588 3:135089988-135090010 CTGACAAACCTGAAGGCAGTTGG + Intronic
962941986 3:140133487-140133509 CAGAGAAACCTGGAAGCAGTTGG + Intronic
963299416 3:143582042-143582064 AAGAAAAGCATGAAGGAAGGAGG + Intronic
963399667 3:144781935-144781957 CAGAGAGACCTGAGGGAGAGTGG + Intergenic
966457824 3:180137717-180137739 CTGCAAAACCTGAAGGAATGAGG - Intergenic
966575403 3:181495506-181495528 CAGAGAATCTTGAAAGAAGGAGG - Intergenic
966916230 3:184585592-184585614 CAGAGAGACCTGAATGGAGTTGG - Intronic
967222860 3:187262830-187262852 CTGAGAAACCCAAAGAAAGGAGG + Intronic
968000510 3:195202572-195202594 CAGTGAAAGCTGAAGAAAGATGG - Intronic
968395418 4:231913-231935 AAGAGAAAGATGAAGGTAGGAGG + Intergenic
969066457 4:4485743-4485765 CACAGAAACCTAATGGTAGGAGG - Intronic
970158796 4:13168621-13168643 CAGAGAAAGTTGTAGGAAGGAGG - Intergenic
970239094 4:13989416-13989438 CTGAGAAACCTCTAGGAAGTAGG - Intergenic
970250803 4:14113959-14113981 CAGAGATATCTGAAGAAATGTGG - Intergenic
970732554 4:19123910-19123932 CAGAGCTAGCCGAAGGAAGGAGG + Intergenic
972315320 4:37920747-37920769 CAAAGGAACATGAAGGTAGGAGG + Intronic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
972790239 4:42364860-42364882 AAGAGAAAGAGGAAGGAAGGAGG - Intergenic
973538517 4:51909644-51909666 CAGAGAACCCTGTGGAAAGGAGG + Intronic
973788422 4:54356701-54356723 CAGAGAGACCTTCTGGAAGGAGG + Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
975785370 4:77881869-77881891 GAGAGAGACCTGAAGGAAGTAGG - Intronic
975940513 4:79638984-79639006 AACAGAAACTTGAAAGAAGGGGG - Intergenic
976424993 4:84892919-84892941 AACAGAAACCTGAATGAATGAGG + Intronic
977334065 4:95673850-95673872 AAGAGAATACTGAAGGAAAGTGG - Intergenic
977898139 4:102386904-102386926 AAGAAAGACTTGAAGGAAGGTGG - Intronic
978761430 4:112358690-112358712 CAGAGGAGCCGCAAGGAAGGAGG + Intronic
978831097 4:113085780-113085802 CTGAGAAATTTGGAGGAAGGGGG + Intronic
980106660 4:128594721-128594743 CAGAGTAAGCTGGAGGGAGGGGG - Intergenic
980140468 4:128909997-128910019 CAGAGAAACCAGAGTGAAGGCGG + Intronic
980305721 4:131059375-131059397 CATAGAAAACTGAGGAAAGGGGG - Intergenic
980743500 4:136983425-136983447 AAGAGAAAGCTAAAGGAAAGTGG + Intergenic
982159956 4:152558527-152558549 CAGAGATAGCTGAAGGGAGAAGG - Intergenic
982366990 4:154590011-154590033 CATAGAAACTTGAAGGAGAGAGG - Intronic
982376069 4:154692321-154692343 CTGTGAAATCTGAAGGGAGGTGG - Intronic
983066606 4:163217417-163217439 AAGAGGAAACTGAAGAAAGGAGG - Intergenic
983801944 4:171942290-171942312 CAGAGAAAAATGAGGGGAGGAGG + Intronic
984019173 4:174464143-174464165 CAAATAAACCAGAAGAAAGGAGG + Intergenic
984453714 4:179938227-179938249 CAGAGAAACCTGACTGTAGTGGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
986203895 5:5605115-5605137 CAGAGAAAGGTCAAGGAAGTGGG - Intergenic
986981790 5:13456634-13456656 CAGTGAAACATGAAGCAAAGTGG - Intergenic
987304317 5:16623447-16623469 CAGAGAAAGCTGAAGAAAGCAGG - Intergenic
987418560 5:17691400-17691422 CAGAGAAAGATGGAGGCAGGTGG + Intergenic
987426492 5:17778852-17778874 CATAAAAACCTGAACGAAGATGG - Intergenic
987480656 5:18453070-18453092 AAGAGAAAAATGAAGCAAGGAGG + Intergenic
988252626 5:28780087-28780109 CAGAGAAGAAGGAAGGAAGGAGG - Intergenic
988503040 5:31799306-31799328 CAGAACAGCCTGCAGGAAGGTGG + Exonic
988927978 5:36008359-36008381 CAGAGAAAAAGGAAGGCAGGGGG + Intergenic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
990425998 5:55689701-55689723 TAGAGAAGCCTGAAGAAAGAGGG - Intronic
990523176 5:56599510-56599532 CAGGGAGACCTGAGGGGAGGAGG + Intronic
990997509 5:61747186-61747208 TAGAAAAACCTCAATGAAGGGGG + Intronic
991578669 5:68131514-68131536 CAGAGATACCTGAATGAGGTAGG - Intergenic
992205935 5:74430326-74430348 CATGGAAACTTGAAGGATGGTGG - Intergenic
993262087 5:85670658-85670680 CACAGAAAAATGAAGCAAGGGGG + Intergenic
993431277 5:87834670-87834692 AAGGGAAACCTGAAAGAAGAGGG + Intergenic
993548910 5:89249345-89249367 CAAAGTAACATGATGGAAGGGGG + Intergenic
993697343 5:91077503-91077525 CAGTGAAACCCAAAGGAATGGGG + Intronic
993817487 5:92569293-92569315 TATAGAAACATGAAGGCAGGTGG + Intergenic
993846211 5:92946924-92946946 CAGAGAAGGCTTAAGGGAGGAGG + Intergenic
994099879 5:95880745-95880767 CAGAGAAAGAGGAGGGAAGGAGG + Intergenic
994160046 5:96547346-96547368 CATAAGAACCAGAAGGAAGGAGG + Intronic
994870287 5:105339401-105339423 TAGAAAAACCTGAAAAAAGGGGG + Intergenic
995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG + Intronic
995712962 5:115053296-115053318 CAGAGAAAGCTAAAAGAAGAAGG + Intergenic
995852828 5:116563902-116563924 CAGAGATATCTGAGGGGAGGTGG + Intronic
996914701 5:128698482-128698504 CAGAGAAACTTGAAGGAAAGAGG - Intronic
997263817 5:132483448-132483470 CAGTGAAATGTGAAGGAAAGTGG - Exonic
997529872 5:134575418-134575440 CAGAGAAACTGGAAGGAGGCTGG + Intronic
997775929 5:136604993-136605015 CAGAAAAAGAGGAAGGAAGGTGG - Intergenic
998019743 5:138759474-138759496 AAGAGAAAAATGAAGGAAGTAGG + Intronic
998503135 5:142651071-142651093 CAGAGAGAGGTGAAGGAAGGCGG + Intronic
999117248 5:149174671-149174693 CAGTGTATCCTGAAGGAAAGAGG - Intronic
999198951 5:149802535-149802557 TCGAGAAGCCAGAAGGAAGGAGG - Intronic
999968823 5:156838378-156838400 CAGAGGAATCTGAAGGAAGGCGG + Intergenic
1000693231 5:164348441-164348463 CACAGAAACCAGAAGAAAAGTGG - Intergenic
1001234250 5:170015935-170015957 GAAAGAAACAAGAAGGAAGGAGG - Intronic
1002053250 5:176583929-176583951 CAGAGAAACAGGAAGCAAGCAGG + Intronic
1002696778 5:181097660-181097682 CAGCGAATCCTGCTGGAAGGCGG - Intergenic
1002697844 5:181101713-181101735 CAGCGAATCCTGCTGGAAGGCGG + Intergenic
1002825642 6:771079-771101 CAGAGAGAAAGGAAGGAAGGAGG - Intergenic
1003040694 6:2684999-2685021 CAGGGCAACCTGGAGGAAAGTGG - Intronic
1003175000 6:3747610-3747632 AAGAGAGACATGAAGGAAAGCGG - Intronic
1003429399 6:6025197-6025219 CATTGAAACCTGAAGGAAAAAGG + Intergenic
1003540267 6:7012515-7012537 CAGTGAGTCCTGAAGGAAGGAGG + Intergenic
1005438764 6:25842361-25842383 TGTAGAATCCTGAAGGAAGGAGG - Intronic
1005492684 6:26361094-26361116 TAGAGAAGCCTGAGGGAAGCTGG - Intergenic
1005522824 6:26614830-26614852 GAGAGAGACGTGAAGGAAGAGGG - Intergenic
1005997267 6:30939096-30939118 TGGAGAAACCTGGAGGTAGGTGG - Intergenic
1006367341 6:33623145-33623167 CTGATAAAGCTGAGGGAAGGAGG + Intronic
1006384417 6:33721847-33721869 CAGAAGAACCTGGAGGACGGAGG - Exonic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1008543392 6:52564973-52564995 CAGAGAAGCATGAAGGAGGAGGG + Intronic
1009527034 6:64760532-64760554 CATAGCAACCTGAAGAAAAGGGG - Intronic
1010771851 6:79840963-79840985 AAGAGAAACCTCCAGGAAAGAGG + Intergenic
1011931601 6:92721520-92721542 CAAAGAGAAATGAAGGAAGGGGG - Intergenic
1015903229 6:138089062-138089084 CAGAGAATCTTGAAGGTAGGGGG + Exonic
1017577232 6:155818459-155818481 CAGAGAAAGCAAGAGGAAGGAGG + Intergenic
1017682403 6:156877429-156877451 AAGAGACACCTGAAGGAAACAGG - Intronic
1017751793 6:157495538-157495560 CAGAGAGGCATGAGGGAAGGAGG + Intronic
1019767575 7:2863154-2863176 CAGAGAAGACTGCAGGAAGTGGG - Intergenic
1019908944 7:4086621-4086643 CAGAGAGATGAGAAGGAAGGAGG - Intronic
1020961458 7:14809379-14809401 GAGTGAAACATGAAGGAGGGAGG + Intronic
1020963012 7:14829471-14829493 CAGGGAAACTAGAAGGGAGGAGG + Intronic
1021034022 7:15774655-15774677 CACAGACACTTGAAGGATGGTGG - Intergenic
1021066070 7:16174239-16174261 TAGAAAAACCTCAAGGATGGGGG + Intronic
1021850458 7:24803400-24803422 AAGAGAAAGCTCAAGGCAGGTGG - Intronic
1022384299 7:29887469-29887491 CAGAGAAGGCTGGAGGAAGTAGG + Intronic
1022505676 7:30907583-30907605 CAGAGAACCCTGATGGAGGGTGG - Intergenic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1022935944 7:35176563-35176585 CAAAGAGAGATGAAGGAAGGAGG + Intergenic
1023842030 7:44103517-44103539 CAGAGGACCCAGAAGGCAGGTGG - Intergenic
1024930574 7:54663888-54663910 CAGAGGGACATGAAGGAAGCAGG + Intergenic
1025283556 7:57645776-57645798 CAGAGCACCCTGAAAGAAGATGG - Intergenic
1026876910 7:73884688-73884710 CAGTGAAAGCTGATGGGAGGAGG - Intergenic
1026931847 7:74227309-74227331 AAGAGAAACCTGAACCCAGGAGG - Intronic
1027197118 7:76038280-76038302 CAGAGAGGTCTGAAGGAATGTGG + Intronic
1029006768 7:97219071-97219093 CAGAGAAACCTAAAGCACGATGG + Intergenic
1030324871 7:108208423-108208445 TAGAGGAAGCTGAGGGAAGGAGG - Intronic
1030740181 7:113100284-113100306 GAGAAAAAAATGAAGGAAGGGGG - Intergenic
1031485991 7:122325209-122325231 CACAGTTACCTGAAGGAAGTAGG - Intronic
1033141668 7:138832533-138832555 CTGAAAAACCTGGAGGAAGAAGG + Intronic
1035057715 7:156046994-156047016 CAGACAGAAATGAAGGAAGGGGG + Intergenic
1035109980 7:156473367-156473389 CAGAAAAACTGTAAGGAAGGTGG + Intergenic
1035587157 8:785533-785555 CAGAGAGACCTGAGGGGAGGAGG - Intergenic
1035587255 8:785802-785824 CAGAGGAGCCTGAGGGGAGGAGG - Intergenic
1036465400 8:8992685-8992707 CAGAGAAAAAGGAAGGAAGCAGG + Intergenic
1036631565 8:10519448-10519470 GGAAGACACCTGAAGGAAGGCGG - Intergenic
1036662944 8:10719813-10719835 CAGAGAAAGCTGAATGCAAGTGG + Intergenic
1037109165 8:15145135-15145157 CAGAGAAGCCAGAAGGACTGAGG - Intronic
1037331549 8:17748365-17748387 CATGGACACCTGAAGGATGGTGG - Intronic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1037952427 8:23027901-23027923 CAGAGACACCCTGAGGAAGGGGG + Intronic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1038196638 8:25374137-25374159 CAGAGAAACACGGAGGCAGGAGG + Intronic
1038326802 8:26577965-26577987 GAGAGAAACAGGAGGGAAGGGGG - Exonic
1038387779 8:27165729-27165751 CAGAAATACCTGATGGAAGTGGG - Intergenic
1038524709 8:28262987-28263009 CAGGAAGACCTGAAGGAAAGGGG + Intergenic
1039118473 8:34118909-34118931 CAGAGAAACCTGAAGGCAGGTGG - Intergenic
1039161590 8:34627595-34627617 CTGAGAAACAGCAAGGAAGGTGG - Intergenic
1039215794 8:35269313-35269335 CAGAGAGACAGGAAGGAAGATGG - Intronic
1039978597 8:42387791-42387813 CAGAAAGACCTGAAGCAAGAAGG - Intergenic
1040338353 8:46427494-46427516 CAGAGAGACCGCAAGGAATGTGG + Intergenic
1040384026 8:46901067-46901089 GAGAGAAACCTGAAGTAGGAGGG - Intergenic
1040449229 8:47527304-47527326 CAGAGAAACAGGAAGGCTGGAGG - Intronic
1041360944 8:57053440-57053462 AAGAGAAACCAGAATGAAGAAGG - Intergenic
1042320175 8:67467578-67467600 AAGAGAAACCGCAAGGAATGTGG - Intronic
1042375047 8:68040437-68040459 AAGAGAAGGCTAAAGGAAGGAGG - Intronic
1042443857 8:68860890-68860912 CAGAGAGACCTGAATCAAGCCGG - Intergenic
1042472611 8:69208714-69208736 CTGAGAAATCTGAAGGGAGCTGG - Intergenic
1042817338 8:72892004-72892026 CAGAGCAGCTTGAAGGAAAGTGG + Intronic
1042880244 8:73479928-73479950 CAGGGAAACCAGTAGGAAGACGG - Intronic
1043972637 8:86549222-86549244 CAAAGAAATCTAAAGTAAGGTGG + Intronic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1045947272 8:107810781-107810803 CAGTCAAAGCTGAAGAAAGGAGG - Intergenic
1046326354 8:112652315-112652337 AATTGAAACCTGAAGGAAGGGGG - Intronic
1048456614 8:134584247-134584269 CAGAGAAAGCTGCAGGGTGGAGG - Intronic
1048706778 8:137162501-137162523 CACTGAAAACTGAAGGAAAGTGG + Intergenic
1049329503 8:142042785-142042807 CAGAGAAAACGGGAGGAAGCGGG + Intergenic
1049445432 8:142628441-142628463 CAGCCAAACCTGAAGAAAGGAGG - Intergenic
1049644390 8:143729554-143729576 CAGAGAACCCTGGATGAGGGTGG + Intronic
1049702431 8:144021268-144021290 GAGAGGGACCTGAGGGAAGGGGG - Intronic
1050085250 9:1958584-1958606 CTGAGAAACTTCAGGGAAGGGGG + Intergenic
1052128115 9:24804619-24804641 CAGAGAAATCTGAATGAAATAGG - Intergenic
1055146127 9:72936986-72937008 CAGTGAAACCTAGGGGAAGGTGG + Intronic
1055730272 9:79273804-79273826 GAGAGAAAGAGGAAGGAAGGAGG + Intergenic
1057774251 9:97993094-97993116 CAGAGATACCTAAAGAAAAGTGG + Intronic
1058215684 9:102230694-102230716 GACAGAAACTGGAAGGAAGGTGG - Intergenic
1058422562 9:104846381-104846403 CATAGAAACATCAAGAAAGGTGG - Intronic
1059691405 9:116688515-116688537 CAGATAATCCTGAAGGAGTGTGG + Intronic
1059744535 9:117187263-117187285 AAGAAAAACCTGAAGGAACTGGG + Intronic
1059764180 9:117367832-117367854 CATAGAAACCTGGAGGAAGGAGG + Intronic
1060690712 9:125656833-125656855 CAGAGACACAAGAAGGCAGGGGG + Intronic
1060729329 9:126027336-126027358 AAGAGCAACCTGGAGGAAAGAGG - Intergenic
1060958659 9:127663426-127663448 CAGAGGAACCTTAAGGCCGGAGG - Intronic
1061579213 9:131526634-131526656 CAGACAAAGCTGAGGGAAGAGGG + Intronic
1061934514 9:133849991-133850013 CAGACAAGCCTGAGAGAAGGGGG - Intronic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1062725583 9:138071595-138071617 GAGAGAAGCCAGGAGGAAGGGGG + Intronic
1185518381 X:717924-717946 AAGAGAAACTGGAAGGAAGCAGG - Intergenic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1185975118 X:4711488-4711510 CAGGACAACCTGAAGCAAGGCGG + Intergenic
1186490822 X:9970602-9970624 CAGAGATTCCTGTAGGAAGAAGG - Intergenic
1187831774 X:23389429-23389451 CTGACAAACCTTCAGGAAGGAGG + Intronic
1189634044 X:42985980-42986002 CAGAGAGACATGGAGGCAGGGGG + Intergenic
1190485879 X:50924510-50924532 CAGATGAACCTGGAGGATGGAGG - Intergenic
1192119462 X:68441340-68441362 AAGAGAAACTTGAAGGGAGTGGG - Intergenic
1192331870 X:70182185-70182207 CAGAGGGACAAGAAGGAAGGAGG + Intronic
1193173619 X:78365987-78366009 TTGAGAAAACTGAAGGAAAGAGG + Intergenic
1193369754 X:80680575-80680597 CTGGAAAACCTTAAGGAAGGTGG + Intronic
1193530236 X:82647155-82647177 CAGGGCAACTTGAAGCAAGGAGG + Intergenic
1195618404 X:106930599-106930621 CAGAGAAGGCTCAATGAAGGAGG - Exonic
1195666634 X:107437342-107437364 CAGAGAAAGCACAAGGCAGGAGG - Intergenic
1195718068 X:107837629-107837651 CAGATAAACCTCAGTGAAGGAGG + Intronic
1195853211 X:109305443-109305465 CACAGACACTTGAAGGATGGTGG + Intergenic
1197260234 X:124309397-124309419 TAGAGAAACCTGAAGAAATTTGG + Intronic
1198659406 X:138951207-138951229 CAGAGTAAGCTGATGGGAGGCGG - Intronic
1199072297 X:143491549-143491571 CAAAGAAACCAGAGGGAAAGGGG - Intergenic
1199735060 X:150678356-150678378 AAGAGAAACCTCAGGTAAGGGGG + Intergenic
1199857580 X:151772907-151772929 CACAGAACCCTGTGGGAAGGGGG - Intergenic
1200055708 X:153459325-153459347 CAGAAAAACCTACAGAAAGGCGG - Intronic
1201679584 Y:16629184-16629206 CAGAGGAACCAGAAGACAGGAGG + Intergenic