ID: 1095554111

View in Genome Browser
Species Human (GRCh38)
Location 12:43480788-43480810
Sequence TCCACATGCTGAGGGAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 252}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095554111 Original CRISPR TCCACATGCTGAGGGAGTGT GGG Intronic
900188294 1:1343027-1343049 TCCCCATGCTGGGGGGGTGGGGG - Intronic
900552542 1:3264041-3264063 TCCACAAGCTTAGGGAGCATAGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
904335651 1:29795950-29795972 TCCAAAGGCTTAGGGAGAGTGGG + Intergenic
906502020 1:46348332-46348354 TACCCATGCTGTGGGAGCGTAGG - Intronic
908569359 1:65392604-65392626 TCCACATCCTCAGGGGGTGGAGG - Exonic
911041153 1:93592041-93592063 TCCACATGTTCAGGAAGTGAAGG - Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913531568 1:119737564-119737586 TCCACATGCCGTGGGAGTGAAGG + Intronic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915958004 1:160239502-160239524 TCCACATGCTCAAGGAATCTAGG + Intronic
923063170 1:230495575-230495597 GCCTAATGCTGAGGGAATGTGGG - Intergenic
1063598302 10:7457500-7457522 CCCACATGCTCAGGGAGAGAAGG - Intergenic
1064339699 10:14474979-14475001 GTCACATCCTGAGGTAGTGTGGG - Intergenic
1065479183 10:26175669-26175691 TCCACATGCTTAAGAAGAGTAGG - Intronic
1066706021 10:38178898-38178920 TCCACATGGTGAGAGAGGGAGGG + Intergenic
1068726469 10:60308623-60308645 TCAACAGGCTGAGGGAGGGGAGG + Intronic
1070138409 10:73716066-73716088 ACCATATGCTAAAGGAGTGTTGG - Intergenic
1070378115 10:75854118-75854140 TGGACATGCTGTGGGAGTGCAGG + Intronic
1070423834 10:76265542-76265564 TCCACATGGTCAGGAAGTTTTGG + Intronic
1072019557 10:91384401-91384423 TCTCCATGCTGTGGGAGTGTGGG + Intergenic
1072360207 10:94652128-94652150 TCCACAGGCTTAGGGAGATTGGG + Intergenic
1075490494 10:122863798-122863820 TCCACATACTGGGCCAGTGTCGG + Intronic
1075699365 10:124459112-124459134 GCCACATGCTGAGAGAGTGGTGG + Intergenic
1076428342 10:130383278-130383300 TCCACACCCTGAGGGAATGGAGG + Intergenic
1076429355 10:130391001-130391023 TCCAGAGGCAGAGGGAGTGAGGG + Intergenic
1077077291 11:707394-707416 TCCACATGCTGAGTGACCTTGGG - Intronic
1077390947 11:2300405-2300427 TCCTCTTGCAGAGGGAATGTTGG + Intronic
1077477298 11:2796553-2796575 TCCCCATGGAGAGGGTGTGTCGG - Intronic
1077580409 11:3413731-3413753 CCCGCATGGTGTGGGAGTGTGGG + Intergenic
1079004590 11:16782889-16782911 TGCACATGCTGTAGGAGGGTCGG + Intronic
1079106765 11:17576949-17576971 TCCACATGGTAAAGGAGAGTGGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1084237335 11:67796560-67796582 CCCACATGGTGTGGGAGTGTGGG + Intergenic
1084710869 11:70843063-70843085 TCCACATGCTGTGAGAGTCCAGG - Intronic
1084835067 11:71796268-71796290 CCCGCATGGTGTGGGAGTGTGGG - Intronic
1085885605 11:80518282-80518304 TCCACATACTGGGGGTGGGTGGG - Intergenic
1088019097 11:105097568-105097590 TCCTCAGGCTGTGGCAGTGTGGG - Intronic
1089322136 11:117633614-117633636 CCCACATGCTGAAGGATTGAGGG - Intronic
1095554111 12:43480788-43480810 TCCACATGCTGAGGGAGTGTGGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096259563 12:50082190-50082212 TCCACATGGTGTGAGAGAGTGGG - Exonic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1097843633 12:64344801-64344823 TCCAAAGGCTTAGGGAGTTTGGG - Intronic
1101998578 12:109542514-109542536 GCCACATGCTGAGGTAGTGGGGG - Intergenic
1102988594 12:117298525-117298547 GCCACATTCTGAGGCAGTTTAGG - Intronic
1103848477 12:123915763-123915785 TCCATTTGCTGAGGGACAGTTGG + Intronic
1104706314 12:130950144-130950166 CCCAAATGCTGAGGGAGAGCTGG - Intergenic
1105777439 13:23676849-23676871 TCCACATGCTCTGGGGGGGTTGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1108200250 13:48036262-48036284 TCCAAATGCTGAGGTACTGGGGG + Intergenic
1109109707 13:58301163-58301185 TCTACCAGCTGAGGCAGTGTAGG + Intergenic
1109487402 13:63045043-63045065 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1111899216 13:94180560-94180582 GCTACATGCAGAGGGAGTGACGG + Intronic
1113720352 13:112551522-112551544 TCCAGTTGCTGAAGGAGTGATGG - Intronic
1115478974 14:33843346-33843368 TAAACATGCTGTGAGAGTGTGGG + Intergenic
1115491504 14:33962822-33962844 TCTACTTGATGGGGGAGTGTGGG + Intronic
1116395984 14:44449209-44449231 TCCTTATGTTGAGGGAGTGTTGG + Intergenic
1116597525 14:46869836-46869858 TCCACATGGTGAGGAATTGAGGG + Intronic
1117045525 14:51809445-51809467 TCTACATGCTGCTGCAGTGTGGG - Intergenic
1118994015 14:70821333-70821355 TCCACTTCCTTAGGGAGTGTGGG + Intergenic
1119410563 14:74427422-74427444 CCCACATCCTGTGGGAGTGAAGG - Intergenic
1119436265 14:74599811-74599833 TGCCCATGCTCAGGGAGTGCTGG - Intronic
1119656884 14:76423624-76423646 GTCACATCCTGAGGGAGTGCAGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122647539 14:103205378-103205400 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1122695788 14:103551429-103551451 TCCACAGGGTGAGGGAGAGAAGG - Intergenic
1123218635 14:106836579-106836601 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1124252609 15:28116918-28116940 GCCACATGGTGTGGGAGCGTTGG - Intronic
1124781809 15:32642959-32642981 GCCACATGCTGAGTGATCGTAGG - Intronic
1127918007 15:63471360-63471382 TCCAAATGCTGAAGGAGACTGGG + Intergenic
1128200766 15:65805036-65805058 TTCACATGCTGATGGAGTTCAGG - Intronic
1128600568 15:68992161-68992183 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1129604161 15:77016665-77016687 TCCACCTGCTGAGGGTGGGCTGG + Intronic
1130395178 15:83495051-83495073 TCCACCTGCAGAGGGTGTATGGG + Intronic
1131761213 15:95624468-95624490 TCAAAATGTTGTGGGAGTGTTGG - Intergenic
1132146544 15:99432960-99432982 TCCACAGGCAGAGGGCGTGGGGG - Intergenic
1133348951 16:5088983-5089005 CCCCCATGGTGTGGGAGTGTGGG + Intronic
1133978594 16:10617584-10617606 TCCATCTGCTGTGAGAGTGTAGG - Intergenic
1136750091 16:32627468-32627490 CCCACATGCTGAGGGTGTGATGG + Intergenic
1137420166 16:48326587-48326609 ACCACATTCTGAGGAATTGTGGG + Intronic
1141518391 16:84561598-84561620 AGCACCTGCTGAGGGAGTGCTGG + Intergenic
1141533881 16:84665697-84665719 TCCAGATGCTGAGGGGAAGTGGG + Intronic
1141592256 16:85076978-85077000 TCCACTGGCTAAGGGAGTTTGGG + Intronic
1141748979 16:85945745-85945767 GCCACAAGCTGTGGGACTGTGGG + Intergenic
1141951443 16:87342573-87342595 TCCACTTGCTGAGGGGTTGCTGG - Intronic
1203052219 16_KI270728v1_random:886667-886689 CCCACATGCTGAGGGTGTGATGG + Intergenic
1142552075 17:747059-747081 ACCACCTGCTGCGGGAGTGGGGG - Exonic
1142874286 17:2842074-2842096 TCCACAACCTGGGGGAGTATTGG + Intronic
1142965810 17:3580329-3580351 TGAACATGCTGAGGGAATGACGG - Intronic
1144893358 17:18508780-18508802 TATACATGCTGTGTGAGTGTGGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1146671387 17:34740516-34740538 TTAAAATGCTGAGGGAGTGAAGG + Intergenic
1146812403 17:35914488-35914510 TCCACCTCCTGAGGGAGATTTGG + Intergenic
1149073739 17:52574492-52574514 GCCACATCCTGAGGGAGGGAAGG - Intergenic
1149077012 17:52607654-52607676 CCCACATGTTGAGGGAGGGAGGG + Intergenic
1149140064 17:53421575-53421597 TCCACAGACTGGGGGAGGGTGGG - Intergenic
1150124784 17:62628801-62628823 TCCACTTCCTGGGGGAGTGGGGG + Intronic
1151324852 17:73373027-73373049 GCCAGAGGCTGAGGGAGTGAGGG - Intronic
1152016588 17:77755054-77755076 TTCACATGCTCAGGGAAAGTCGG + Intergenic
1152939904 17:83162924-83162946 TCCAGATGCTGATGGGGTGCTGG + Intergenic
1153378066 18:4403936-4403958 CCCACTTGCTCAGAGAGTGTGGG + Intronic
1153954239 18:10082734-10082756 TCCAAAGGCTGTGGGAGAGTGGG + Intergenic
1157304678 18:46508296-46508318 GTCACATTCTGAGGGACTGTGGG - Intronic
1158297077 18:56010149-56010171 CCCACATGCTGTGGGAGGGACGG - Intergenic
1158372861 18:56829402-56829424 TCCACATGGGGAGGGGGTGCTGG - Intronic
1160066795 18:75583148-75583170 TCCACTTGCTTAGGGAGGCTGGG + Intergenic
1160156271 18:76436219-76436241 TCCTCATTCTGAGGGGGTCTTGG - Intronic
1160726283 19:619161-619183 TCCACTTGCTTAGGGAGTCCTGG + Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164541723 19:29126516-29126538 TCCCCAAGATGAGGAAGTGTCGG + Intergenic
1165638722 19:37365635-37365657 TCCTTATGTTGAGGGAGTGCTGG + Intronic
1167857669 19:52255973-52255995 GCCACATGCTGAGGTACTGGGGG - Intergenic
925610605 2:5697706-5697728 TCTACATGTTGAGGGGGTGTGGG - Exonic
928925992 2:36579863-36579885 TCCACATTCTGAGGCCCTGTGGG - Intronic
929311504 2:40431388-40431410 TACACATGATGAAGGACTGTAGG + Intronic
930594068 2:53364372-53364394 CCCACATGTTGAGGGAGGGGAGG - Intergenic
932466557 2:71927891-71927913 TCCACATGCAGAGGGGTTGGAGG - Intergenic
932851007 2:75186860-75186882 TCAAAATGCTGAGGAAGTATTGG + Intronic
932932361 2:76057422-76057444 TTCACATTCTGAGGTACTGTGGG + Intergenic
935866071 2:107389021-107389043 TCCACATTCTGGGGGAGCGGGGG - Intergenic
936051266 2:109225508-109225530 TCCACATGGTGAGTGTGAGTGGG - Intronic
938104038 2:128518006-128518028 TCCACAGGCCGGGGGAGAGTAGG - Intergenic
938689439 2:133774054-133774076 TGCAAAGGCTGAGGGTGTGTGGG + Intergenic
946481401 2:220060268-220060290 CCCACATGCTGAGGGGCTGATGG - Intergenic
946907344 2:224429638-224429660 TCCACCTCCTGAGGCTGTGTAGG - Intergenic
947073152 2:226313816-226313838 TCAAAATGCTCAGGGAGGGTAGG + Intergenic
947864521 2:233386991-233387013 TCCACATGTTGATGGCGTGTCGG + Intronic
948183446 2:236001016-236001038 GCCACATTCTGAGGTAGTGGGGG - Intronic
948364368 2:237445074-237445096 TCAGCATTCTGGGGGAGTGTTGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1168788639 20:561071-561093 TCCACATAATGAGGGAGTGCTGG - Intergenic
1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG + Intronic
1169262045 20:4146397-4146419 ACCACATGCTAAGGAAGTCTAGG + Intronic
1169381623 20:5112636-5112658 TTCAGGTGCTGAGGGAGTTTGGG - Intronic
1171021372 20:21587120-21587142 GCCACATGCGGAGGGGGCGTTGG + Intergenic
1172162769 20:32879944-32879966 TCCTCATGCTTAGGGAGTCCAGG - Intronic
1173547019 20:43905503-43905525 TACACATGCTGATGTAGTTTAGG - Intergenic
1175039414 20:56032861-56032883 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1175746768 20:61462557-61462579 TGCACAAGCTGAGTGAGTGGTGG - Intronic
1178622557 21:34189256-34189278 TCCTCCTACTGAGGGAGGGTTGG - Intergenic
1178676307 21:34634471-34634493 TCCAGGTGCTGGGAGAGTGTTGG - Intergenic
1179257625 21:39730402-39730424 GCCACATTCTGAGGAACTGTGGG + Intergenic
1179942198 21:44647532-44647554 TCCACCTGCTGAGGGATTTGTGG - Exonic
1183104744 22:35607750-35607772 TCTACATCCTGATGGAGTGGAGG - Intronic
1183408560 22:37642058-37642080 TCCAGATGGGGTGGGAGTGTGGG + Intronic
1184728688 22:46361047-46361069 TCCACTGGCTGAGGGAGCATGGG + Exonic
949588341 3:5465946-5465968 TCCACATGATGAGTGAGGGTTGG - Intergenic
949870469 3:8583705-8583727 TCCAGAAGCAGAGGGAGTGAGGG - Intergenic
950909541 3:16574674-16574696 TCCACTTGATGGGGGAGGGTGGG + Intergenic
955386899 3:58487565-58487587 TGCACATGCTGAGGGTGAGGAGG + Intergenic
955416853 3:58700269-58700291 TCCACATGGTGAGGAACTGAGGG - Intergenic
956167859 3:66409912-66409934 TCCAAATGCAGAGGAAGTGAAGG + Intronic
956169825 3:66424237-66424259 TCCACTTGCTGTGGGAGTGGGGG - Intronic
956888627 3:73586887-73586909 TCCAACTGCTGATGGAGTGCAGG + Intronic
957053281 3:75426326-75426348 CCCGCATGATGTGGGAGTGTGGG + Intergenic
957819434 3:85351632-85351654 TGCACAGGCTGAGGGAATGTGGG + Intronic
959869116 3:111306495-111306517 TTCACATGCTGTTGGAGTGTAGG - Intronic
960952940 3:123011444-123011466 TCCATATGCACAGGGAATGTGGG - Intronic
961301546 3:125925217-125925239 CCCGCATGGTGTGGGAGTGTGGG - Intergenic
961333300 3:126155445-126155467 TCCTCAGGCTGAGGGAGTCTGGG + Exonic
961351065 3:126303428-126303450 TCTAAATGCTGAAGGAGTGGAGG - Intergenic
961512479 3:127411539-127411561 GCCACATGCTGGGAGAGGGTGGG - Intergenic
961627581 3:128274523-128274545 GCCACATGTTGAGGGAGCCTAGG + Intronic
961886924 3:130102640-130102662 CCCGCATGGTGTGGGAGTGTGGG + Intronic
962333352 3:134501011-134501033 TGCATATGGTGAGGAAGTGTAGG + Intronic
964945238 3:162214627-162214649 TCCACATGTGGAGTGAGTGGAGG - Intergenic
967156199 3:186694810-186694832 CCCACATGGGGAGGGAGTGGAGG + Intergenic
967201539 3:187076420-187076442 TCCACATGGAGAGGGAAAGTGGG - Exonic
967395045 3:188998803-188998825 ACCAGAGGCTGAGGGGGTGTGGG + Intronic
967988141 3:195111341-195111363 GTCACATTCTGAGGGAGTGGTGG + Intronic
968070939 3:195784011-195784033 TGTGGATGCTGAGGGAGTGTCGG + Exonic
968407285 4:351845-351867 TCCACAGGCAGAGGCAGTGAGGG + Intronic
968578299 4:1378043-1378065 TCCACTTGGTGAGGGAATGTGGG - Intronic
968996082 4:3946644-3946666 CCCGCATGGTGTGGGAGTGTGGG + Intergenic
969059699 4:4424978-4425000 CCCACAAGCTGAGGGAGTTGTGG + Intronic
969227525 4:5808462-5808484 CTCACCTGCTGAGGGTGTGTCGG + Intronic
969338120 4:6523556-6523578 TCCAAATGCAAAGCGAGTGTTGG + Intronic
969343028 4:6554116-6554138 GTCACATGCTGAGGTATTGTGGG - Intronic
969817883 4:9699596-9699618 CCCGCATGGTGTGGGAGTGTGGG - Intergenic
971278853 4:25224407-25224429 TCCTTATGTTGAGGGAGTGCTGG + Intronic
972530894 4:39960376-39960398 TCCAAAGGCTGAGGGATTCTGGG + Intronic
973362968 4:49182001-49182023 GTTACATGCTGAGGGACTGTGGG - Intergenic
973398131 4:49614855-49614877 GCTACGTGCTGAGGGACTGTGGG + Intergenic
975497687 4:75052600-75052622 TCCAAATGCTGAGGGAGAAATGG - Intergenic
975559582 4:75696472-75696494 TCCACATGGTGAAGGACTGTTGG - Intronic
977870432 4:102083818-102083840 GCCACATTCTGAGGTACTGTGGG - Intergenic
978533346 4:109736183-109736205 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
979092407 4:116501924-116501946 GCCACATGCTGAGGTACTGAAGG - Intergenic
979191101 4:117859728-117859750 TCCACTTGATCAGGGAGGGTGGG + Intergenic
980302975 4:131017814-131017836 TCCACTTGATGGGGGAGGGTGGG - Intergenic
982166437 4:152617735-152617757 CCCTGATGCTGTGGGAGTGTGGG + Intergenic
982819281 4:159926446-159926468 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
983160123 4:164402964-164402986 AGCACTTGCTGAGGGAGTGCGGG + Intergenic
983498579 4:168473511-168473533 TCCACATGGGAAGGGAGAGTTGG + Intronic
984180804 4:176480239-176480261 TCCACTTGCTGGGGGTGGGTGGG + Intergenic
985748810 5:1662692-1662714 TCCCCAGCCTGCGGGAGTGTGGG - Intergenic
986381656 5:7192597-7192619 GCCACATGCTGAGGTATTGGAGG + Intergenic
986757688 5:10853514-10853536 TCCACATCCTGCAGGAGTGAGGG + Intergenic
992045840 5:72888356-72888378 TCAACCTTCTGATGGAGTGTTGG + Intronic
992107106 5:73458594-73458616 TTCACATTCTGAGGTACTGTAGG + Intergenic
996004942 5:118408194-118408216 TCCACTTGCTGTGGGAATTTAGG - Intergenic
996540718 5:124628356-124628378 TGAACTTGCTGAGGGAGTGGAGG - Intergenic
1001991853 5:176123487-176123509 TCCACACGCTGAGGGTGTGATGG + Intronic
1002081191 5:176738452-176738474 TCCCCATGGTGAGGGTGTGAGGG + Intergenic
1002225020 5:177714665-177714687 TCCACACGCTGAGGGTGTGATGG - Intronic
1003178542 6:3771957-3771979 CCCAAGGGCTGAGGGAGTGTGGG + Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1003696169 6:8408144-8408166 TCCAAAGGCTTAGAGAGTGTGGG - Intergenic
1004603193 6:17170418-17170440 TCCCTGTGCTGAGGGAGTGAAGG + Intergenic
1006411769 6:33877940-33877962 ACCACAGGCTGAGGGAGGCTTGG + Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1006922885 6:37638028-37638050 TACACAGCCTGAGTGAGTGTGGG + Intronic
1009678363 6:66857329-66857351 TCCAGATGCTGCCCGAGTGTAGG - Intergenic
1010653239 6:78479669-78479691 TGCAAGAGCTGAGGGAGTGTGGG - Intergenic
1010654639 6:78497575-78497597 CCTACCTGATGAGGGAGTGTAGG - Intergenic
1011550501 6:88527474-88527496 TCCCAATGCTGAGGGAGGGAAGG + Intergenic
1011622235 6:89253770-89253792 TCCACCTGCTGTGGGTGGGTGGG - Intergenic
1012906563 6:105073591-105073613 TCCACATTCTGAGGGTCTGATGG - Intronic
1015058213 6:128929950-128929972 TCCGCAGGATGAGGGAGTGGTGG - Intronic
1016265095 6:142223337-142223359 TCCACATCATTAGGGAGTCTGGG + Exonic
1016576518 6:145574641-145574663 TCCAAAGGCTTAGGGAGTTTGGG - Intronic
1018274611 6:162117490-162117512 CCCACCTGCTGAGGGAGACTTGG - Intronic
1018753078 6:166824374-166824396 GCCACCTGCTGAGGCAGTGCCGG - Intronic
1019599411 7:1873830-1873852 TCCAGATGCTGAGGGACTCCTGG + Intronic
1019924396 7:4182606-4182628 TCCTCATCCTGAGGGAGAGGAGG + Intronic
1020320355 7:6935054-6935076 CCCGCATGGTGTGGGAGTGTGGG + Intergenic
1023875319 7:44283451-44283473 TCCACATGCTGAGGGCCACTTGG + Intronic
1024106901 7:46098844-46098866 ATCACATGCAAAGGGAGTGTTGG + Intergenic
1024594290 7:50918859-50918881 TCCACTGGCTCAGGGAGTCTGGG - Intergenic
1024958524 7:54951125-54951147 TCCACAGGCTTAGGGAGATTGGG - Intergenic
1029460559 7:100691784-100691806 TTCAGATGCTGGGGGAGTGAGGG - Intergenic
1030495870 7:110299374-110299396 TCCAGATTCTGTGGGAGAGTGGG + Intergenic
1032670497 7:134077950-134077972 TCCTTATGTTGAGGGAGTGCTGG + Intergenic
1032724512 7:134578142-134578164 TCCACAGGCTTAGGGAGGGAGGG + Intronic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033154383 7:138944235-138944257 TTCAGATGCTGGGGTAGTGTGGG - Intronic
1033709383 7:143925174-143925196 TCCACAGGATGTGGGATTGTAGG + Intergenic
1034020767 7:147639937-147639959 TCCATATGCTCTGGGAGTCTTGG + Intronic
1034570791 7:151954663-151954685 TCCACATGCTGTAGGAATTTGGG + Intergenic
1034775369 7:153822006-153822028 GCCACATGGAGAGGGAGAGTTGG - Intergenic
1035860349 8:3021690-3021712 TCCAGATGCTGTGGGATTGCAGG - Intronic
1035860353 8:3021718-3021740 TCCAGATGCTGCGGGATTGCAGG - Intronic
1035860444 8:3022230-3022252 TCCAGATGCTGTGGGATTGCGGG - Intronic
1037209123 8:16363693-16363715 TTCACATTGTGAGGGACTGTGGG - Intronic
1039839200 8:41281363-41281385 CCCCCATGCTGAGGGAGTGAGGG - Intronic
1039911695 8:41831789-41831811 TTCACACGCTGAGGACGTGTGGG - Intronic
1039919472 8:41883135-41883157 CACACACGCTGTGGGAGTGTGGG - Intronic
1041570926 8:59336205-59336227 TGGACACGCTGAGGCAGTGTAGG + Intergenic
1042848280 8:73190139-73190161 TCCACAACCTGAGTGAGTTTAGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1047398826 8:124528798-124528820 TCCTTATGTTGAGGGAGTGCTGG - Intronic
1048326380 8:133442450-133442472 TCCCAGTGCTGAGGGAGAGTAGG - Intergenic
1049047844 8:140166628-140166650 TCCTCATGCTGGAGGAGTGGAGG - Intronic
1053272770 9:36761607-36761629 TCTGCTTGGTGAGGGAGTGTAGG + Intergenic
1055115981 9:72606021-72606043 TCCACATTCTGAGGTGGTGGGGG + Intronic
1056578648 9:87874182-87874204 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1056699736 9:88892314-88892336 GCCACATTCTGAGGGAATGGGGG - Intergenic
1057201459 9:93142549-93142571 GCCTCATGCTGAGGGACAGTGGG - Intergenic
1057891840 9:98875518-98875540 GCCACATTCTGAGGTACTGTGGG + Intergenic
1060097519 9:120805362-120805384 TCCTGATGTTGAGGGAGTGCTGG + Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1188807985 X:34614874-34614896 TCCAGGTGTTGAGGGAGGGTGGG - Intergenic
1189373389 X:40447429-40447451 TCCACATGCTGTGGGATGGATGG - Intergenic
1190399166 X:50014437-50014459 TGCACGTGCTGAGTTAGTGTGGG + Intronic
1191645369 X:63474910-63474932 TCCTTATGTTGAGGGAGTGCTGG - Intergenic
1193212093 X:78819327-78819349 TTCACATGCTGATGGACTCTTGG - Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1197002027 X:121450902-121450924 TCCAAAGGCTTAGGGAGTTTGGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1200849137 Y:7864708-7864730 GCCACATTCTGGGGGACTGTGGG + Intergenic
1201264905 Y:12196680-12196702 TCTGTATGCTGAGGGAGTGCTGG - Intergenic
1201340714 Y:12930327-12930349 TCCACATGATGAGGGATTGAAGG + Intergenic
1201416696 Y:13754300-13754322 TCCAGAAGCTGAGGAAGTGGAGG + Intergenic