ID: 1095557151

View in Genome Browser
Species Human (GRCh38)
Location 12:43521569-43521591
Sequence TTTGAATGATAAGAGGCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095557151 Original CRISPR TTTGAATGATAAGAGGCCGA AGG (reversed) Intronic
903434789 1:23339834-23339856 TGTTATTGATAAGAGGCTGATGG - Intronic
906419777 1:45655564-45655586 TTTGCATGAAAGGAGGCGGAGGG + Intronic
911077009 1:93885843-93885865 TTTCAATGATAAAAGGTCTAAGG - Exonic
912513182 1:110201966-110201988 TTTCAATGAGAAGAGGCCCTAGG - Exonic
912753902 1:112308604-112308626 TTTGAATAATAAGAGGCTAATGG + Intergenic
913322310 1:117597558-117597580 CTTGAATGATCACAGGGCGATGG + Intergenic
913733219 1:121740077-121740099 TTTGAATGCTTTGAGGCCTACGG - Intergenic
913932903 1:125000868-125000890 TTTGAACGATTTGAGGCCTATGG + Intergenic
913934684 1:125024232-125024254 TTAGAATGATTTGAGGCCTATGG + Intergenic
922209789 1:223478543-223478565 TTTGATTGATAGGAGGAGGAAGG + Intergenic
924454171 1:244204907-244204929 TTTGAAGGAGGAGAGGCAGATGG + Intergenic
1064952927 10:20874404-20874426 TTTGAATGATCTGAGGCTGGAGG + Intronic
1066238094 10:33506479-33506501 TATGACAGATAAGAGGACGAGGG - Intergenic
1066336408 10:34482462-34482484 TTTGAATGGTCAGAGGCCTGGGG - Intronic
1066448125 10:35502660-35502682 TTTGAAATTTAAGGGGCCGAGGG - Intronic
1070289302 10:75104300-75104322 TCTGAAAGATAAGGGGCCCATGG - Intronic
1073068187 10:100776562-100776584 TTTAAAAGACAAGAGGCCTAAGG - Intronic
1074723671 10:116285733-116285755 TATGAATTCTAAGAGGCAGATGG + Intergenic
1079191769 11:18283807-18283829 TCTGAATGATATGAGCCTGATGG - Exonic
1079290346 11:19182748-19182770 TGTGAATGAGAAGAGGATGAAGG + Intronic
1081819399 11:45977048-45977070 GGTGAATGGTAAGAGGCCCAGGG - Intronic
1082156542 11:48825154-48825176 TTGGAATGGTAAGAGGCCTATGG + Intergenic
1086957476 11:92948614-92948636 TTTCCATGATAGGAGGCGGAGGG + Intergenic
1088410767 11:109531912-109531934 TTGGAATGATGAGAGGCCAGAGG + Intergenic
1095031748 12:37294601-37294623 TTTGAGTGCTTAGAGGCCTAAGG + Intergenic
1095056402 12:37608879-37608901 TTGTAATGATTAGAGGCCTATGG + Intergenic
1095557151 12:43521569-43521591 TTTGAATGATAAGAGGCCGAAGG - Intronic
1099742916 12:86664331-86664353 TTTAAATGAAAAGAGACAGAAGG - Intronic
1104471542 12:129033711-129033733 TTTGAAGGATAGCAGGCCTATGG - Intergenic
1104487547 12:129164303-129164325 TTTTAATCATACCAGGCCGATGG - Intronic
1105216385 13:18289027-18289049 TTTGACTGACAAGAGGCTCAGGG - Intergenic
1107375267 13:39797643-39797665 TTTGAATTATAAGAGGCTTAAGG + Intergenic
1109115328 13:58375125-58375147 TTTGAAAGATAAGAGCCTGAGGG + Intergenic
1109239448 13:59866613-59866635 TTTGATTGATAAGATTCAGATGG - Intronic
1114490608 14:23099331-23099353 GGTGAATGGTAAGAGGCAGATGG + Exonic
1117574716 14:57086378-57086400 CTTGAATAATAAGATGCCCAGGG - Intergenic
1121414701 14:93771362-93771384 TTTGAAGGTTGAGAGGCTGATGG - Intronic
1124149534 15:27165187-27165209 TTTGCCTGATATGAGGCAGATGG + Intronic
1126142642 15:45450594-45450616 TTTTATAGATAAGGGGCCGAAGG + Intergenic
1126464211 15:48946179-48946201 TTTAAGTGATAAGAGGGAGAAGG - Intronic
1128713521 15:69889966-69889988 TTTGACTGAGGAGAGGCAGAAGG + Intergenic
1131514555 15:93068392-93068414 CTTGGAAGATAAGAGGCTGAAGG - Intronic
1131604491 15:93886543-93886565 TTTGACTGGGAAGAGGCCTAGGG + Intergenic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1136915496 16:34189892-34189914 TTGGAATGATTTGAGGCCTATGG - Intergenic
1138166573 16:54807438-54807460 TTTGAATTATAAGGGGTAGAGGG + Intergenic
1139917537 16:70437936-70437958 TTTGACTGAAAAGAGGCCCCAGG + Intronic
1140137691 16:72222306-72222328 TTGGAATGAAAAGAAGCTGAGGG - Intergenic
1145689796 17:26728263-26728285 TTTGAATGATAACTGGCCATTGG + Intergenic
1147703030 17:42407784-42407806 AGTGAATGATAAGAGGCAGAGGG - Intronic
1153176678 18:2382246-2382268 TTTGAATGAACAGAGCCAGATGG + Intergenic
1155260528 18:24038059-24038081 TTTGAATTATAAGAGGTAAATGG - Intronic
1164349711 19:27321119-27321141 TTGGAGTGATATGAGGCCTATGG + Intergenic
1164352080 19:27360758-27360780 TTGGAATGCTATGAGGCCTATGG - Intergenic
1164353763 19:27390442-27390464 TTGGAATGATTTGAGGCCTATGG + Intergenic
928985986 2:37182137-37182159 TTTCAATGGTAAGAGGCAGGAGG - Intronic
932252879 2:70259443-70259465 TTTGAAAGAGAAGAGGTCGGGGG + Exonic
933033883 2:77367709-77367731 TCTGAATGATAAGAGACGGTAGG + Intronic
934117789 2:88812730-88812752 TTTGAGAGATAAGAAGCAGATGG + Intergenic
934297940 2:91757697-91757719 TTTGACTGACAAGAGGCTCAGGG + Intergenic
937564685 2:123269973-123269995 TTTGAATGATAAGAGTCAAGAGG - Intergenic
938750987 2:134329909-134329931 TTTTAATGATAAAATGCAGATGG - Intronic
940473816 2:154134331-154134353 TTTGAGTGATCAGAGGTTGAAGG + Intronic
944959344 2:204853132-204853154 GATGAATGATAAGATGCCCATGG - Intronic
945339317 2:208632721-208632743 TTTGGATGATGAGAGGCACATGG + Intronic
946245184 2:218383340-218383362 TATGAAGGAAAAGAGGCCCAGGG + Intronic
1171734325 20:28755894-28755916 TGTGAATGCTTAGAGGCCTATGG - Intergenic
1171807480 20:29693822-29693844 TTGGAGTGCTAAGAGGCCTACGG + Intergenic
1171909783 20:30937757-30937779 TTGGAATGATTTGAGGCCTATGG - Intergenic
1172102620 20:32494506-32494528 TTTGGGTGTTAAGATGCCGAAGG - Intronic
1175375876 20:58523648-58523670 TTTGTATGATAAAAGGCAGTGGG + Intergenic
1176319058 21:5289941-5289963 TTTGAGTGATTTGAGGCCTATGG - Intergenic
1177664479 21:24136235-24136257 TTTCAATGATTTGAGGCGGAGGG - Intergenic
1177812747 21:25942215-25942237 TTTCAATGAAAAGATGCTGAAGG + Intronic
1178387559 21:32165741-32165763 TTTGAATGATGAGAGCTCCATGG + Intergenic
1180396652 22:12352375-12352397 TTTGAGTGATTTGAGGCCTATGG - Intergenic
1180403061 22:12511754-12511776 TTTGAGTGATTTGAGGCCTATGG + Intergenic
1203330717 22_KI270738v1_random:83200-83222 TTTGAATGCTTTGAGGCCTATGG - Intergenic
949812636 3:8022503-8022525 TGTGAATGGTATGAGGCAGAGGG + Intergenic
957424226 3:80016581-80016603 TTGGAATGATAAGAGACAGTGGG - Intergenic
958129891 3:89405073-89405095 TGTGAAGGATAAAAGGCAGATGG + Intronic
958686084 3:97397178-97397200 TTTGTAAGATCAGAGGCTGATGG - Intronic
960134981 3:114095701-114095723 TTTTAATGATAAGAGGGCTGAGG + Intergenic
973635096 4:52854780-52854802 TTAGAAGGAGAAGAGGCAGAGGG + Intergenic
973764397 4:54149923-54149945 TGAGAGTGATAAGAGGCCCAAGG - Intronic
980772454 4:137394361-137394383 TTTGACTGCTAAGAGGCAGCTGG + Intergenic
982718060 4:158829665-158829687 TATGAAGGATAAAAGGCTGATGG + Intronic
983312845 4:166087440-166087462 TTTGAAGGATTAGAGGCCACTGG - Intronic
984651636 4:182276747-182276769 TTTGAAAGATAATAAGCAGAAGG - Intronic
988329925 5:29823285-29823307 TTTGAATAATAAGACCCTGAAGG - Intergenic
989942964 5:50175493-50175515 TTTGAGTGCTTAGAGGCCTATGG - Intergenic
989945041 5:50214267-50214289 TTTGAGTGCTTAGAGGCCTATGG - Intergenic
989945233 5:50218012-50218034 TTTGAACGATTTGAGGCCTATGG - Intergenic
996572695 5:124949290-124949312 TTTGAATGTTTAGAGACCAATGG + Intergenic
997160558 5:131604899-131604921 TTTGAATGAATAGAGGCCATTGG - Intronic
997247094 5:132358993-132359015 TGTGACTGATGAGAGGCCCAGGG - Intergenic
1001470540 5:172008970-172008992 TTTGAATGATAAAAAGCCACAGG - Intergenic
1003749438 6:9040035-9040057 TTTGAATAATCAGATGCAGAAGG - Intergenic
1008689238 6:53959102-53959124 TTTGAATCATATGTGGCAGATGG - Intronic
1013823974 6:114188908-114188930 TTTGAATGGAAACAGGCAGAAGG - Intronic
1018173666 6:161161428-161161450 AGTGAATGGTAAGAGGCAGAGGG + Intronic
1021213961 7:17892740-17892762 TTTGTATGAAGAGAGGCAGATGG - Intronic
1021432515 7:20576645-20576667 TTTGACTGATATGTGCCCGATGG + Intergenic
1023044933 7:36202569-36202591 TTTAAATGATAAGAGGCTTGTGG + Intronic
1023391553 7:39715907-39715929 TCTGTATGAAAAGAGGCTGAAGG + Intergenic
1025314059 7:57995072-57995094 TTTGAGTGATTTGAGGCCTAAGG + Intergenic
1025500044 7:61277549-61277571 TTTGACTGATTTGAGGCCTATGG + Intergenic
1025501207 7:61301115-61301137 TTTGAATGCTTTGAGGCCTATGG - Intergenic
1025514895 7:61623759-61623781 TTTGACTGATTTGAGGCCTATGG + Intergenic
1025516067 7:61647338-61647360 TTTGAATGCTTTGAGGCCTATGG - Intergenic
1025539239 7:62052599-62052621 TTTGACTGATTTGAGGCCTATGG + Intergenic
1025540404 7:62076164-62076186 TTTGAATGCTTTGAGGCCTATGG - Intergenic
1031370381 7:120958338-120958360 TTATAGTGATAAGAGGCAGAGGG - Intronic
1033920978 7:146391367-146391389 TTTGAAAGATAAAAAGCAGATGG - Intronic
1036443868 8:8804967-8804989 TTTGAAAGATAGGAGGGAGAAGG + Intronic
1043685090 8:83074478-83074500 TTTGAATAATAAAAGCACGAAGG + Intergenic
1045722549 8:105130878-105130900 TTTCAATGATCAGAGGCCTAGGG - Intronic
1047249078 8:123167954-123167976 TTTGAATATTAAAAGGCCGATGG - Intergenic
1047442275 8:124888759-124888781 CCTCAATGATAAGAGGCTGAAGG - Intergenic
1053687191 9:40544793-40544815 TTGGAATGCTATGAGGCCTACGG + Intergenic
1054424150 9:64988836-64988858 TTGGAATGATTTGAGGCCTATGG + Intergenic
1203420269 Un_KI270374v1:2596-2618 TTTGACTGATTTGAGGCCTATGG + Intergenic
1186965393 X:14781508-14781530 TCTGAAGGATGAGAGGCAGAAGG + Intergenic
1189516865 X:41721199-41721221 TTTGAATGAGAAAAGTCCAAAGG + Intronic
1191572551 X:62648322-62648344 TTTGAGTGATTTGAGGCCTATGG + Intergenic