ID: 1095559792

View in Genome Browser
Species Human (GRCh38)
Location 12:43551702-43551724
Sequence GGAGTCCCGGGAGCTCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 219}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095559788_1095559792 -7 Left 1095559788 12:43551686-43551708 CCGGCTGACTGGTCCGGGAGTCC 0: 1
1: 0
2: 1
3: 3
4: 71
Right 1095559792 12:43551702-43551724 GGAGTCCCGGGAGCTCCAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 219
1095559782_1095559792 13 Left 1095559782 12:43551666-43551688 CCGGCGCAGTCGCGACCTCTCCG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1095559792 12:43551702-43551724 GGAGTCCCGGGAGCTCCAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 219
1095559781_1095559792 14 Left 1095559781 12:43551665-43551687 CCCGGCGCAGTCGCGACCTCTCC 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1095559792 12:43551702-43551724 GGAGTCCCGGGAGCTCCAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 219
1095559780_1095559792 22 Left 1095559780 12:43551657-43551679 CCTCGAAACCCGGCGCAGTCGCG 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1095559792 12:43551702-43551724 GGAGTCCCGGGAGCTCCAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 219
1095559786_1095559792 -2 Left 1095559786 12:43551681-43551703 CCTCTCCGGCTGACTGGTCCGGG 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1095559792 12:43551702-43551724 GGAGTCCCGGGAGCTCCAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095559792 Original CRISPR GGAGTCCCGGGAGCTCCAGC AGG Intronic
901011804 1:6206470-6206492 GGGGCCGCGGGAGCTCAAGCGGG + Intronic
901150222 1:7096367-7096389 GGAGTCCTGGGAGCCCCACAAGG - Intronic
901478871 1:9510231-9510253 GGAGTCCCTGCAGCTTAAGCTGG - Intergenic
901645082 1:10712613-10712635 GGAGCCCCGGGAGCCCCACTCGG - Intronic
902251457 1:15156287-15156309 GGAGCCCCAGAAGCTCCAGCTGG - Intronic
902561920 1:17282941-17282963 GGAGGCCCAGCGGCTCCAGCAGG - Exonic
902573754 1:17363617-17363639 GGAGGCCCAGTGGCTCCAGCAGG - Exonic
902583316 1:17423020-17423042 GAGGTCCGGGGAGCTGCAGCAGG - Intronic
903240730 1:21981031-21981053 GTAGGTCCGGGAGCTCCTGCGGG - Exonic
903468466 1:23568450-23568472 GAGGTCCCGGGAGTCCCAGCGGG - Intergenic
904531203 1:31170922-31170944 AGGCTCCCTGGAGCTCCAGCTGG + Intergenic
907296476 1:53459299-53459321 TGTGTCCCGGGAACTGCAGCAGG - Intergenic
913211325 1:116584984-116585006 GGAGACCCGGCAGGTACAGCTGG - Exonic
915589155 1:156860865-156860887 GGAGGCCTGGCAGCTGCAGCTGG + Intronic
916053030 1:161049242-161049264 GGAGTCCAGGGAACAGCAGCTGG + Exonic
917028232 1:170664407-170664429 TGAGTCCCGGCGACTCCAGCAGG - Exonic
919742979 1:200991686-200991708 GGAGTCCCAGAAGCGGCAGCAGG - Exonic
920513684 1:206568603-206568625 GTCCTCCAGGGAGCTCCAGCTGG + Intronic
922167425 1:223127841-223127863 GGAGTCTGCAGAGCTCCAGCAGG - Intronic
922739298 1:228006661-228006683 CGCGGCCCGGGAGCTCCAGGAGG + Intergenic
922951135 1:229558967-229558989 GGAGCGCCGGGCGCGCCAGCTGG + Intergenic
923361777 1:233218954-233218976 GGAGCCAGGAGAGCTCCAGCAGG + Intronic
923500496 1:234560026-234560048 GGCTTCCTGGGAGCTCCAGAAGG - Intergenic
1062989971 10:1806115-1806137 TGAGTCCCGGGTGCTGCAGCAGG - Intergenic
1064185924 10:13161712-13161734 GGGGTCCCGGGAGCTCGGGTGGG + Intronic
1064478908 10:15720045-15720067 GGACTCCCGGGCGGCCCAGCTGG + Exonic
1067201111 10:44172831-44172853 CGAGTCCAGGGCTCTCCAGCAGG + Intergenic
1069573459 10:69508040-69508062 CAAGTCCCGGCATCTCCAGCAGG - Intergenic
1069636575 10:69928967-69928989 GGAATCCCTGGAGCTCCAGGTGG - Exonic
1071966555 10:90857932-90857954 GGAGTCGAGGGAGCTCGGGCTGG + Intergenic
1072451813 10:95544741-95544763 GGGGTCAAAGGAGCTCCAGCAGG - Intronic
1073330291 10:102666016-102666038 GGAGACTAGGGAGCTGCAGCGGG - Intergenic
1074815889 10:117140493-117140515 GGAGGCCCAGGAGCTCCCTCGGG - Intergenic
1074983227 10:118636029-118636051 AGAGACCTGGGAGCTCCAGGGGG - Intergenic
1075732237 10:124643529-124643551 AGAGCCCCGGGAGGGCCAGCGGG + Intronic
1075788838 10:125068904-125068926 GGAGAACCCGGTGCTCCAGCTGG - Intronic
1076500063 10:130930095-130930117 TGACTCCCGGCAGCTCCAGCAGG + Intergenic
1077152187 11:1077377-1077399 GGGGTCCCGGGAGGACAAGCTGG + Intergenic
1077249054 11:1552616-1552638 GGAGCACCTGCAGCTCCAGCAGG - Intergenic
1077311614 11:1891332-1891354 GGAGTCCTGGGGGCTGCCGCTGG + Intronic
1077457622 11:2690420-2690442 GGGGTCCTGGGAGCTAGAGCTGG + Intronic
1078930002 11:15905573-15905595 GGACTCCCGGCAGCGCCTGCTGG + Intergenic
1079366523 11:19814719-19814741 GGAGTCCCAGCTGCTCCAGAAGG - Intronic
1081488263 11:43547907-43547929 GGAGCCCAGGGAGCCCGAGCTGG - Intergenic
1083970496 11:66070972-66070994 GGAGTCCCGGGAGGCCTGGCTGG - Intronic
1086133855 11:83427292-83427314 GAAGTCCAGGGAGCCCCAGTTGG - Intergenic
1089126117 11:116177755-116177777 GGAGGCCTGGGTGCCCCAGCTGG - Intergenic
1089215237 11:116830870-116830892 GGAGTCCCAGGTGGCCCAGCAGG + Exonic
1089791357 11:120946929-120946951 GGAGTCTCGGGTGTTCTAGCTGG - Intronic
1091392238 12:132606-132628 GGGGTCCCAGGAGCTACAGGAGG + Intronic
1095559792 12:43551702-43551724 GGAGTCCCGGGAGCTCCAGCAGG + Intronic
1097035583 12:56121562-56121584 GGAGCAGCTGGAGCTCCAGCAGG - Exonic
1097166649 12:57089650-57089672 GGATGCCCTGGAGCTCGAGCTGG + Intronic
1097281265 12:57846521-57846543 GGAGTCTCGGGAGCCGGAGCGGG - Exonic
1098970883 12:76855681-76855703 AGAGTCCAGGGAGATCCAGGTGG - Intergenic
1102826192 12:115949673-115949695 GGAGTCCCGGGAGGGACAGAGGG + Intergenic
1104568319 12:129903985-129904007 AGAGCCCCGCGAGCCCCAGCCGG - Intergenic
1104882343 12:132081287-132081309 AGAGGCCAGGGAGCACCAGCCGG - Intergenic
1104989654 12:132618621-132618643 GGAGTCCCGGGTGTCCCAGGTGG - Intergenic
1106249094 13:27970669-27970691 GGAGTGCCGCGAGCGCCCGCGGG - Exonic
1113453502 13:110430584-110430606 GGTCTCCCTGGAGCTCCAACTGG - Exonic
1113582158 13:111437488-111437510 GGTGCCCTGGGAGCTCCATCTGG - Intergenic
1113632574 13:111898111-111898133 AGATGCCTGGGAGCTCCAGCAGG + Intergenic
1118039021 14:61897846-61897868 GAAGACCCAGGAGCTCCAGAGGG - Intergenic
1118916098 14:70107746-70107768 GGATTGCAGGGAGCTCCTGCTGG - Intronic
1122767574 14:104082551-104082573 GGAGTGCTGGGAGCACAAGCTGG - Intergenic
1122920708 14:104878821-104878843 GAAAGCCCAGGAGCTCCAGCAGG - Intronic
1125388375 15:39164063-39164085 GAAGTCCTGGAACCTCCAGCAGG - Intergenic
1129206943 15:74043018-74043040 TGAGTCCAGTGACCTCCAGCTGG + Exonic
1130868597 15:87952744-87952766 GGAGTCCCGAGAGGTCACGCTGG + Intronic
1132655939 16:1041674-1041696 GGCAGCCTGGGAGCTCCAGCAGG + Intergenic
1132757680 16:1493858-1493880 GGAGGGCCGGCAGCTCCCGCGGG + Intronic
1132830079 16:1923698-1923720 GGAGTTCCTGGAGCTCCTCCTGG - Intergenic
1134258473 16:12630885-12630907 GGAATCCAGGGAGGTGCAGCTGG + Intergenic
1135303523 16:21350406-21350428 GGGCTCCCGGGAGCTCATGCTGG + Intergenic
1136300268 16:29329600-29329622 GGCCTCCCGGGAGCTCATGCTGG + Intergenic
1136411647 16:30081149-30081171 GCAGTCCTGGAAGCTCCAGGGGG - Intronic
1137750539 16:50858264-50858286 GGGGACCTGGGAGCTACAGCAGG + Intergenic
1138352990 16:56356428-56356450 GCAGCCCCTGGAGCTCCTGCTGG + Intronic
1140481536 16:75265327-75265349 GGAGTCCCGGGAGCGCCGCAGGG + Intronic
1141698971 16:85633785-85633807 GCAGCCCCGGGGGCTCCAGCAGG - Intronic
1142190619 16:88715685-88715707 GGAGACTCGGGAGCTGGAGCTGG - Exonic
1142232444 16:88906147-88906169 GGAGTCTCTGGAGCTCCCACCGG + Intronic
1142785758 17:2221294-2221316 GATGTCCCGAGAGCTCCATCAGG - Intronic
1142799625 17:2337247-2337269 GAAGTCAGGGGAGCTTCAGCGGG + Exonic
1143914046 17:10275813-10275835 GGAGTCACAGGGGCTCCATCAGG - Intergenic
1144950235 17:18989978-18990000 GGAGTTCTGGGAGTCCCAGCTGG - Intronic
1146393589 17:32444422-32444444 GGAGCCACGGGAGCTACAGGCGG + Exonic
1150211978 17:63446567-63446589 GGAGGGCCGGGAGCTCCCCCGGG + Intergenic
1152511900 17:80795684-80795706 GGAGTCCGAGCAGCTCCATCTGG + Intronic
1152573982 17:81132250-81132272 GGAGTCAAGGGACTTCCAGCTGG + Intronic
1152713740 17:81888217-81888239 TGAGTCCCGGGGGAGCCAGCTGG - Intronic
1153488956 18:5629243-5629265 GGGGTACCGGGAGCTGGAGCTGG + Intronic
1155071850 18:22324232-22324254 GCAGTCTTGAGAGCTCCAGCGGG + Intergenic
1157849033 18:51030431-51030453 GGCGGCCCGGGAGCTCGAGGCGG + Exonic
1160110463 18:76024808-76024830 GGAGTCCTGGGAGCTACATAAGG + Intergenic
1160935465 19:1592592-1592614 GGAGTGCCCGGCGCTCCCGCAGG - Exonic
1163364074 19:16866391-16866413 GGAGTGGCGGGAGGCCCAGCAGG + Exonic
1163535796 19:17875649-17875671 GGAGTAGCTGGAGCTACAGCAGG - Intronic
1163830054 19:19543296-19543318 GCAGTCCCCGCAGCTCCAGGTGG - Exonic
1163848918 19:19652702-19652724 GCAGGCCCGGGAGGTCAAGCGGG - Exonic
1167415046 19:49365589-49365611 GGAGAACCAGGAGCACCAGCTGG + Exonic
1168102665 19:54149307-54149329 GGATTCTCGGGTGCTCCACCAGG - Intronic
1168128077 19:54298281-54298303 GGAGCCCCAAGAGCACCAGCTGG - Intergenic
1168507164 19:56945997-56946019 GGAGTCCCGAAAGCTCAACCTGG + Intergenic
1168536042 19:57171959-57171981 GGGGTCCGGGGAGCGCGAGCGGG + Intergenic
925277996 2:2663869-2663891 GGAGTCCCGGGACCTTCTCCAGG - Intergenic
925308959 2:2868344-2868366 TGACTCCGGGGAGCTCCCGCGGG - Intergenic
926796649 2:16625219-16625241 GGGGGCCTGGGAGCCCCAGCTGG - Intronic
926973743 2:18492626-18492648 GGAGTCCAGGGAGCTGCTGGAGG - Intergenic
934650545 2:96089158-96089180 GGACCCCAGTGAGCTCCAGCGGG + Intergenic
937084130 2:119159212-119159234 AGAGTCCCGTGAGGTCCAGCGGG + Intergenic
937957575 2:127430233-127430255 GGCTTCCCGGGCTCTCCAGCTGG + Intergenic
938122938 2:128646336-128646358 GGAGACCGGGGAGCTGCATCCGG - Intergenic
940597594 2:155815194-155815216 CCTGGCCCGGGAGCTCCAGCTGG + Intergenic
943525139 2:189006949-189006971 GCAGGACCGGGAGCACCAGCAGG - Exonic
946173810 2:217910616-217910638 AGGGTCCCGGGAGTGCCAGCTGG - Intronic
946427973 2:219609416-219609438 GGAGGCCAGGGACCTCCTGCTGG + Exonic
947257597 2:228182659-228182681 TGAGTCCCAGGATCTCTAGCTGG - Intergenic
947818484 2:233054249-233054271 GGGCTCCTGGGGGCTCCAGCGGG - Intergenic
947937367 2:234019759-234019781 GGAGTCCCCGGGGCTACAGATGG - Intergenic
948578428 2:238968810-238968832 GGGGTTCCAGGAGCTCCAGCAGG - Intergenic
948902747 2:240964595-240964617 GGAGTTCCCGGAGCTCCTGACGG - Intronic
1168767417 20:391232-391254 GGACTCCCGGGAGCTGAGGCTGG - Intronic
1169123868 20:3113357-3113379 GGAGACATGGGGGCTCCAGCAGG + Intronic
1169381727 20:5113179-5113201 GGAGTCCCGGTGCCTCCTGCAGG - Intergenic
1169800317 20:9506997-9507019 AGGCTCCCGGGAGCTGCAGCTGG + Intergenic
1171223412 20:23421113-23421135 GGCGTCCTGGGGGCTCCAGGGGG + Intronic
1172359668 20:34303219-34303241 TGAGTCCCAGGACCTGCAGCCGG - Intronic
1173880281 20:46406566-46406588 GGAGACCCGGGAGCAGGAGCTGG - Exonic
1174048894 20:47753763-47753785 GGAGCCTCTGGGGCTCCAGCAGG - Intronic
1174238562 20:49114587-49114609 GGTGTCCCGGGAGAACCAGCTGG + Exonic
1176020372 20:62959598-62959620 GGAGCCCCAGGAGCTCCGCCAGG + Intronic
1178680385 21:34669152-34669174 AGAGTCCAGGGAGTTTCAGCTGG + Intergenic
1179830144 21:43991602-43991624 GGAGTCACGTGCGCTCCTGCGGG - Intergenic
1180559212 22:16601924-16601946 GAAGCCCCGGGAGCAGCAGCAGG - Intergenic
1181291708 22:21799467-21799489 GCAGTCCTGAGAGCTCCAGCAGG - Intronic
1181633830 22:24165200-24165222 GGAGTTCAGGGGCCTCCAGCTGG + Intronic
1182150583 22:28024496-28024518 GGAGTCACAGGAGTTCCAGTGGG - Intronic
1182557673 22:31137912-31137934 GGTGGCCCGGGAGCTCCAGGAGG + Exonic
1183481759 22:38069139-38069161 TGAGTCCCCGGGGCCCCAGCTGG - Intronic
1183735616 22:39643328-39643350 GAATTCCAGGGAGCTCCACCGGG - Intronic
1184059665 22:42074280-42074302 GGAGGCGCGGGATCTCGAGCTGG + Exonic
1184335744 22:43852119-43852141 GGAGTCCCGGGATATCCACAGGG + Intronic
1184358941 22:44002208-44002230 GGAGTCTCAGGATCTCCAGGGGG + Intronic
1184461465 22:44640328-44640350 GGAGGCCCGGGAGTTCCCTCAGG + Intergenic
1184728840 22:46362204-46362226 GGTGGCCCGGGAGCTGCAGGTGG - Exonic
1184740873 22:46428465-46428487 GGAGTCCTGGTAGCTTCAGGTGG - Intronic
1184749546 22:46477438-46477460 GGAGTGCCGGGAACTCCTGTGGG + Intronic
1184924590 22:47627981-47628003 GGAGTCCTGGCAGCTCCCACAGG + Intergenic
1184935635 22:47718374-47718396 AGAGTCCCTGGAGCTCCTTCCGG - Intergenic
1185219663 22:49622995-49623017 GGAGTTCCGTGAGCTCCGTCTGG - Intronic
1185260398 22:49858554-49858576 GCAGTCACGGTAGCTCCAGCTGG - Intronic
1185276088 22:49950712-49950734 GGACCCCCGGCAGCTCCAGCAGG - Intergenic
1185297154 22:50060018-50060040 GGAGGCCTGGGAGATGCAGCTGG - Exonic
949602376 3:5614061-5614083 GGAGTCCCAGCAGCCGCAGCAGG - Intergenic
949953702 3:9250327-9250349 GGAGCCCCGGGAGCTTCAGAAGG - Intronic
950496484 3:13337170-13337192 GGAGTCCCTGGAGCTCTAGGAGG + Intronic
950566337 3:13771960-13771982 GCTGTCTTGGGAGCTCCAGCGGG + Intergenic
953903479 3:46856766-46856788 GGAGTCAGGGCAGCTCCAGGGGG - Intergenic
954290252 3:49645983-49646005 GGAGTCCCAGGAGGTCTAACAGG - Intronic
954460472 3:50623868-50623890 GGAGCCCTGGCAGCCCCAGCTGG + Intronic
954812765 3:53258042-53258064 GAGGTCCCTGGAGCTCCAGGTGG - Intergenic
957560192 3:81812308-81812330 GGCCTGCCGGGAACTCCAGCTGG + Intergenic
960993067 3:123324274-123324296 GGACTCCCTGGAAATCCAGCAGG - Intronic
961336062 3:126180400-126180422 GGAGCCCCCGGAGCTGCAGCCGG + Intronic
961404133 3:126666943-126666965 GGAGTCCCTGGAGCTCTAGGAGG - Intergenic
961674206 3:128555147-128555169 GGAGTCCCGGGAGGGGCAGCGGG + Intergenic
966448985 3:180036720-180036742 CGAGTACCCGGAGCTCCAGGGGG - Exonic
968232517 3:197012119-197012141 GGTGTTCCGGGAGCTTCCGCAGG - Intronic
968509975 4:991274-991296 GGTGGACCGGGAGCTCCAGCTGG - Exonic
968572546 4:1349677-1349699 GGAGTTCCTGGAGCTCACGCTGG + Exonic
968728465 4:2259025-2259047 GGAGGCCCGGGAGCCCTGGCTGG - Intronic
969343387 4:6556450-6556472 GAAGTCCCCTGAGCTCCATCCGG - Intronic
969533118 4:7740442-7740464 GGAGTCCCGGGGGGTCCCGTGGG - Exonic
969620860 4:8278194-8278216 GGACTCCTGGGAGTTCCATCAGG + Intronic
971294629 4:25377371-25377393 GGAGAGCCGGGGGCTCCTGCCGG + Intronic
972725860 4:41746072-41746094 GCCGCCCCCGGAGCTCCAGCCGG + Exonic
984812320 4:183806404-183806426 GGAGTCCCTGGAGCTCACGGAGG + Intergenic
984878240 4:184388525-184388547 GTAGCCCTGGGAGATCCAGCAGG + Exonic
985621132 5:956712-956734 GGAGTGCCGGCATCTCCTGCAGG - Intergenic
985640860 5:1062965-1062987 AAAGTCCCGGGACCGCCAGCAGG + Intronic
985652181 5:1112316-1112338 GGAGGGCGGGGAGTTCCAGCAGG - Intergenic
985931254 5:3059457-3059479 GGAGTCCCAGGAGCTTCCCCAGG + Intergenic
986232963 5:5883799-5883821 GGAGACCAGGGAGCTCCCCCTGG - Intergenic
991003892 5:61809358-61809380 TGTGGCCCAGGAGCTCCAGCTGG + Intergenic
994206137 5:97037883-97037905 ACAGTCACGGGAGCTCCATCAGG + Intergenic
994843160 5:104951740-104951762 GGAGTTGCTGGAGTTCCAGCAGG + Intergenic
995598465 5:113772095-113772117 AGAGTTCCGGGATCTCCAACAGG - Intergenic
997206989 5:132055978-132056000 GGAGGCCAGGGCTCTCCAGCTGG + Intergenic
1001634114 5:173197485-173197507 GGAGGCCCTTGAGCTCCAGTGGG + Intergenic
1005582887 6:27250797-27250819 GGAGTCGCAGGACCTTCAGCCGG - Exonic
1007165550 6:39826302-39826324 GGAGCCCAGAGAGTTCCAGCAGG - Intronic
1007173136 6:39878519-39878541 GGAGTCCCAGGAGCTGCGCCAGG + Exonic
1013220590 6:108074384-108074406 TGAGTGCCGGGAGCTCCTGCTGG - Exonic
1015817870 6:137229266-137229288 GCAGTCTGAGGAGCTCCAGCTGG - Intergenic
1016992351 6:149938775-149938797 GGAGGCCCGGGAGCATCGGCGGG + Intergenic
1018731709 6:166656551-166656573 AGAGTCACGGGAGCACCTGCCGG - Intronic
1021531126 7:21646636-21646658 GGTGCCCAGTGAGCTCCAGCAGG + Intronic
1029364297 7:100107298-100107320 GGAGTCCCTGGAGCTGGAGGGGG + Exonic
1029524722 7:101087789-101087811 GGAGGCCCGGGAGCGCCAAGCGG + Exonic
1032086815 7:128888812-128888834 GGCACCCCGGGAGCCCCAGCAGG + Intronic
1034618037 7:152435911-152435933 GCAGCCCCGGGAGCAGCAGCAGG + Exonic
1036478433 8:9116376-9116398 GCAGTCCAGGGGGCTCCAGAGGG + Intronic
1037646763 8:20799419-20799441 GGAGTCCTGGGAGCCCAAGGTGG - Intergenic
1039591919 8:38756969-38756991 GGAGTCCCGGGGGCGCCCGCAGG + Intronic
1040841838 8:51792779-51792801 GGAGTTGCGGAAACTCCAGCAGG - Intronic
1043094926 8:75955678-75955700 GGAAGCCCAGGAGCTCCAGGGGG + Intergenic
1048636368 8:136300329-136300351 GGAGTGCAGGGAGCTCCAGCAGG - Intergenic
1049299703 8:141863023-141863045 GGAGTCCTGGCTGCTCCAGTGGG - Intergenic
1049405366 8:142449865-142449887 GGCGCCCGGGGGGCTCCAGCAGG + Exonic
1055406006 9:75974255-75974277 GGACCGACGGGAGCTCCAGCCGG + Intronic
1055436729 9:76299048-76299070 GGAGTTCAGGGAACTCTAGCTGG - Intronic
1056556713 9:87695487-87695509 GGAGTCCTGGGAGCTCCAGGTGG + Intronic
1057294006 9:93824919-93824941 GGAGTCCAGCCAGCTCCTGCTGG - Intergenic
1057313219 9:93954422-93954444 GAGTCCCCGGGAGCTCCAGCGGG - Intronic
1060932601 9:127498177-127498199 GGAGGCCCCGGGGCTCCAGGGGG + Intronic
1061433249 9:130544520-130544542 GGAGTCCCAGGGGCTCAGGCGGG - Intergenic
1061900685 9:133670627-133670649 GGAGGCCCTGGAGCAGCAGCGGG - Exonic
1061933783 9:133846497-133846519 GGAGCCCTGGGGGTTCCAGCAGG - Intronic
1062104092 9:134743338-134743360 TGACTCCCGAGAGCGCCAGCTGG + Intronic
1062110933 9:134781794-134781816 GGAGCCCCGGGAGCTGGCGCTGG + Intronic
1062440367 9:136566929-136566951 GGAGTCCCGGGACCTCCTTGGGG - Intergenic
1062690264 9:137837914-137837936 GGAGCCCAGGGGGCCCCAGCCGG + Intronic
1185491216 X:518469-518491 GGAGTCCCGGGACCTCCCCAGGG + Intergenic
1186430954 X:9503737-9503759 GGAGTTACTGGAGATCCAGCAGG - Intronic
1187384868 X:18839374-18839396 GGAATCCCGGGAGCCCACGCTGG - Intergenic
1192357992 X:70421735-70421757 GGAGGCCAGGGAGGACCAGCAGG - Intergenic
1198327309 X:135586581-135586603 GGGGTGCCGGGGGCACCAGCAGG - Intergenic
1198337334 X:135679527-135679549 GGAGCCCCAGGGGCTGCAGCTGG + Intergenic
1198341675 X:135720143-135720165 GGAGCCCCAGGAGCTGCTGCTGG - Intronic
1198346323 X:135763218-135763240 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198348229 X:135780503-135780525 GGAGCCCCAGGAGCTGCTGCTGG + Intergenic
1198350131 X:135797766-135797788 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198352041 X:135815039-135815061 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198353949 X:135832307-135832329 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198355857 X:135849557-135849579 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198357768 X:135866836-135866858 GGAGCCCCAGGAGCTGCTGCTGG + Intergenic
1198359686 X:135884118-135884140 GGAGCCCCAGGAGCTGCTGCTGG + Intronic
1198361859 X:135903287-135903309 GGAGCCCCTGGGGCTGCAGCTGG - Intronic
1198366540 X:135945896-135945918 GGAGCCCCAGGAGCTGCTGCTGG + Intergenic
1199701062 X:150375966-150375988 GGAGTCCCTGGTGCTACAGTGGG + Intronic