ID: 1095559995

View in Genome Browser
Species Human (GRCh38)
Location 12:43552660-43552682
Sequence GCATGGGCCCCTGTGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 248}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095559993_1095559995 -10 Left 1095559993 12:43552647-43552669 CCGGGCCTCACTTGCATGGGCCC 0: 1
1: 0
2: 4
3: 35
4: 256
Right 1095559995 12:43552660-43552682 GCATGGGCCCCTGTGTGTGCTGG 0: 1
1: 0
2: 5
3: 42
4: 248
1095559990_1095559995 7 Left 1095559990 12:43552630-43552652 CCAATGAAGCTCAGTGACCGGGC 0: 1
1: 0
2: 0
3: 0
4: 49
Right 1095559995 12:43552660-43552682 GCATGGGCCCCTGTGTGTGCTGG 0: 1
1: 0
2: 5
3: 42
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095559995 Original CRISPR GCATGGGCCCCTGTGTGTGC TGG Intergenic
900137413 1:1123964-1123986 GCATGTGCGCAGGTGTGTGCAGG - Intergenic
900284581 1:1892949-1892971 GCAGGCGCCCCTGTGGGGGCGGG - Intergenic
900528933 1:3143237-3143259 ACAGGGACCCCTGGGTGTGCGGG + Intronic
900563724 1:3322217-3322239 GCATGTGCACGTGTGTGTGTGGG + Intronic
902107163 1:14047389-14047411 CCATGGGCTCCTGGGTGTCCAGG - Intergenic
903543263 1:24108493-24108515 GCATGGGCTCCTCTGTGCGGAGG - Exonic
904005740 1:27362264-27362286 GCATGGGCTCCAGTGAGTGTGGG + Intronic
904364602 1:30002313-30002335 GCCTGGGCCCCTGGGAGTTCAGG + Intergenic
907249691 1:53129914-53129936 GCATGGCCCCCTCCGTGGGCAGG - Intronic
908382095 1:63606422-63606444 GCATGGGTCCCTGTGTATAATGG - Intronic
912455757 1:109795846-109795868 GAAGAGGCCCCTGTGAGTGCAGG - Intergenic
915360931 1:155285894-155285916 GCATGGGCTGCTCAGTGTGCTGG + Exonic
916501799 1:165393707-165393729 GCCTGGGCCCTGGTGTATGCTGG + Intergenic
916667068 1:166975842-166975864 GCAGGGGAGCCTGTGTCTGCGGG + Intronic
919878473 1:201887595-201887617 TCCTGGGCCCCTGTGGGTGCTGG - Intergenic
920305541 1:205016014-205016036 GATTGGGTCCCTGTGTGTGGTGG - Intronic
920852049 1:209634629-209634651 GCATGGGCCCCTGTGGAGACAGG + Exonic
922720728 1:227899054-227899076 GCATGAGAACGTGTGTGTGCAGG - Intergenic
1062906466 10:1182968-1182990 GCATGTGCCCCTGGGTGTGGGGG + Exonic
1063033376 10:2258945-2258967 GCATGTGTGCCTGTGTGTGTTGG - Intergenic
1065355213 10:24834282-24834304 GCAGAGGCCCCTGTGTGGTCAGG - Intergenic
1065876325 10:30000366-30000388 ACCTGGGCACCTGTGTGTGGAGG - Intergenic
1067163226 10:43844504-43844526 GGAGGGGGCCCTGTGTCTGCAGG + Intergenic
1069724157 10:70566752-70566774 GCGTGGGGCCCTGTGGGTGGGGG - Exonic
1070784369 10:79154515-79154537 GCAAGGGCCCAGGTGGGTGCCGG + Intronic
1071060980 10:81570736-81570758 TCCTGGGCCCCTGAGAGTGCAGG + Intergenic
1071415123 10:85433968-85433990 GCATGGGGGCCTGAGTGTGGAGG + Intergenic
1072969804 10:100007437-100007459 GGGTGGGCACCTGTGTGTGCCGG - Intronic
1073043457 10:100622523-100622545 GCAAGTGTCCCTTTGTGTGCTGG + Intergenic
1073179961 10:101577735-101577757 GCCTGGGCCCCCGGGTGTGAAGG - Intronic
1076461134 10:130648464-130648486 GCATGTGCACATGTGTGTGCAGG + Intergenic
1076605628 10:131687596-131687618 GAGTGTGCACCTGTGTGTGCTGG - Intergenic
1076841567 10:133048503-133048525 GCCTGGGCCCCTGTGGAGGCCGG - Intergenic
1077042085 11:529329-529351 GGATGGGCCCCTGTGGGTGTGGG + Intergenic
1077183908 11:1228160-1228182 GCATGAGCCCCCCTGTGAGCTGG + Intronic
1077218595 11:1405362-1405384 GCGTGCCCACCTGTGTGTGCAGG + Intronic
1077294970 11:1822208-1822230 CCATGGGGCTCTGTGTTTGCAGG - Intergenic
1077354862 11:2110905-2110927 GCCTGGACCTCAGTGTGTGCTGG + Intergenic
1077520864 11:3033305-3033327 GTTGTGGCCCCTGTGTGTGCTGG - Intronic
1077792904 11:5461063-5461085 GCATGGGGGCACGTGTGTGCTGG + Intronic
1079256643 11:18836807-18836829 GCCTGGGCAGCTGTGTCTGCTGG - Intergenic
1080866955 11:36203944-36203966 GGATGGGCCCCAGTGAATGCTGG + Intronic
1082654522 11:55837158-55837180 GCATGGGACCCTGTTGGTGCTGG + Intergenic
1083979323 11:66153274-66153296 GCATGTGCCACTGTGCCTGCTGG + Intronic
1084236351 11:67790265-67790287 TCATGGCCTCCAGTGTGTGCTGG - Intergenic
1084704695 11:70809342-70809364 GCATGGGTCCCTGTGTGCATGGG - Intronic
1084765497 11:71305625-71305647 GCAGTGGCCCCTGTGTGGGCTGG + Intergenic
1084836061 11:71802727-71802749 TCATGGCCTCCAGTGTGTGCTGG + Intergenic
1085334377 11:75679678-75679700 TCCTGGGCCCCTGAGAGTGCGGG + Intergenic
1085457597 11:76674085-76674107 TCAGGGGCCCATGTGGGTGCTGG - Intergenic
1085507435 11:77068284-77068306 GCCTGAGCACCTCTGTGTGCTGG - Intronic
1087576349 11:99994553-99994575 GCATGAGTCCCTGTGAGTGCTGG - Intronic
1087868819 11:103266362-103266384 GGCAGGGCCCCTGTGGGTGCAGG + Intronic
1088884282 11:113994775-113994797 GCATGGGCACAGGTGTGTGATGG - Intergenic
1089356142 11:117855319-117855341 GCATGGGCCCCTCGGGGTGGCGG + Intronic
1090884772 11:130866036-130866058 AGATGGCCTCCTGTGTGTGCAGG + Intergenic
1091175610 11:133554785-133554807 GCATGGGCCACTCTGAGTGCTGG - Intergenic
1091465277 12:678540-678562 GGGTGGGCCCCTGTGTTTGGAGG + Intergenic
1091551875 12:1541608-1541630 TCAAGGTCACCTGTGTGTGCTGG - Intronic
1091750431 12:3018663-3018685 GCCTGGGCCCCAGGGTGTGCTGG + Intronic
1092929680 12:13304127-13304149 GGATGGGCCACTTTGTGTGGAGG + Intergenic
1093005119 12:14043285-14043307 GCCTGAGCCCCTGTATCTGCCGG - Intergenic
1093317293 12:17667053-17667075 CCCTGGGCCCCTGAGAGTGCAGG + Intergenic
1095559995 12:43552660-43552682 GCATGGGCCCCTGTGTGTGCTGG + Intergenic
1095991091 12:48035116-48035138 GTGTGAGCCTCTGTGTGTGCAGG + Intergenic
1096096204 12:48937350-48937372 CTGTGGGCTCCTGTGTGTGCTGG - Exonic
1097232905 12:57523000-57523022 CCATGGGCCGCGGTGAGTGCGGG + Exonic
1098006271 12:65999841-65999863 GCAGGGGCCCAGGTGTGGGCTGG + Intergenic
1098723267 12:73928936-73928958 GCATTTTTCCCTGTGTGTGCTGG - Intergenic
1102108868 12:110349058-110349080 CCATGGGCTCCTCTGTGGGCTGG - Intronic
1104283984 12:127406283-127406305 ACATGAGCTCCTGTGTGTGTAGG - Intergenic
1105943798 13:25172584-25172606 GCAGGGGTCCCTGTGTGTCCAGG + Intergenic
1108699584 13:52932617-52932639 TCAAGGGCCCATGAGTGTGCTGG - Intergenic
1109276465 13:60309552-60309574 GCATGCTCACTTGTGTGTGCAGG + Intergenic
1110730889 13:78877310-78877332 CCCTGGGCCCCTGAGAGTGCAGG + Intergenic
1112262831 13:97893160-97893182 GCATGTGTGCCTGTGTGTGCAGG + Intergenic
1112343195 13:98569146-98569168 GCACCGGCTTCTGTGTGTGCAGG - Intronic
1112373673 13:98818877-98818899 GCATGAGCCTATGTCTGTGCAGG + Intronic
1113878829 13:113611170-113611192 GCATGGGCACCTTTGTGCTCCGG + Intronic
1114219951 14:20687466-20687488 CCATGGGGCTGTGTGTGTGCAGG + Intronic
1118984253 14:70739991-70740013 ACAGGTGCCCCTGTGTGTTCTGG + Intronic
1119190286 14:72677133-72677155 GTATAGGCCCCGGTATGTGCAGG + Intronic
1119445962 14:74663586-74663608 GCATGCTCCCCTGTGTCTGGAGG - Exonic
1121118119 14:91357850-91357872 CCATGGGGCCATGTGTGTTCCGG - Intronic
1121120203 14:91371718-91371740 ACATGGGACACTGTGTGGGCAGG - Intronic
1122292892 14:100688883-100688905 GCCTGAGCCCCTGTGTTTGCGGG + Intergenic
1122719471 14:103714270-103714292 GCAGGGGTCCTTGTGTGTGGAGG - Intronic
1122827474 14:104377239-104377261 CCAAGGGCCCCTGTGGGTGCTGG - Intergenic
1122921173 14:104880895-104880917 GCATGGGTAGCTGTGTGTGTGGG - Intronic
1123071399 14:105644247-105644269 GCACCTGCCCCTGTGTGTGAAGG + Intergenic
1123091063 14:105742529-105742551 GCACCTGCCCCTTTGTGTGCAGG + Intergenic
1123096829 14:105770863-105770885 GCACCTGCCCCTGTGTGTGAAGG + Intergenic
1123922312 15:25078957-25078979 GCATGGGCTCCTTTGGGTGCCGG + Intergenic
1125345494 15:38714805-38714827 CACTGGGCCCCTGTGTTTGCAGG - Intergenic
1125417305 15:39467116-39467138 GCCTGGGCCTCTGTGTGTCCTGG + Intergenic
1125540299 15:40466266-40466288 GCAGGGGCCCCTGTGGGTTCTGG + Exonic
1126368923 15:47925388-47925410 GCATGGGCCCCTGTGCCTGCTGG + Intergenic
1127556827 15:60095638-60095660 GAAGGTGCCACTGTGTGTGCTGG + Intergenic
1127867044 15:63041897-63041919 GCATGTGTGCGTGTGTGTGCGGG - Intergenic
1128229936 15:66027399-66027421 TCATAGGCCCCTGTCTGTGAGGG - Intronic
1128509126 15:68302790-68302812 GCATGGGCCTGGGTGTGTGTAGG + Exonic
1129159626 15:73740116-73740138 GCATGGGCCTCTGTATGGGCAGG + Exonic
1130253979 15:82317287-82317309 GCATGGGGCTCTCTGTGAGCCGG - Intergenic
1130666775 15:85876384-85876406 GCAAGGGGCTGTGTGTGTGCAGG + Intergenic
1130836663 15:87656475-87656497 GCATGGGCATGTGTGTGTGGAGG + Intergenic
1131265938 15:90915411-90915433 ACAGAGGCCCCAGTGTGTGCAGG - Intronic
1132463996 16:69292-69314 GCATGGTCCTGTGAGTGTGCAGG - Intronic
1133347929 16:5082782-5082804 TCATGGCCTCCAGTGTGTGCCGG - Intronic
1133710388 16:8395648-8395670 GCATGTGTGTCTGTGTGTGCAGG - Intergenic
1136227075 16:28866433-28866455 GGGTGGGCCCCTGGCTGTGCTGG + Exonic
1136284172 16:29231537-29231559 GGCTGGGCCCCTCTGTGTCCCGG + Intergenic
1137592326 16:49701248-49701270 GCATGCGCACGTGTGTGTGTAGG + Intronic
1139269775 16:65671292-65671314 GCTTGTGCAACTGTGTGTGCAGG + Intergenic
1141813391 16:86391893-86391915 GCAGGGGCCCCTCTGTGCACAGG + Intergenic
1142289813 16:89188361-89188383 GTGTGGGCATCTGTGTGTGCCGG - Intronic
1142289819 16:89188407-89188429 GTGTGGGCATCTGTGTGTGCCGG - Intronic
1142289825 16:89188453-89188475 GTGTGGGCATCTGTGTGTGCCGG - Intronic
1142289831 16:89188499-89188521 GTGTGGGCATCTGTGTGTGCCGG - Intronic
1142289835 16:89188529-89188551 GTGTGGGCATCTGTGTGTGCCGG - Intronic
1142289841 16:89188575-89188597 GTGTGGGCATCTGTGTGTGCCGG - Intronic
1142289847 16:89188619-89188641 GCATGGGCATCTGTGTGTGCCGG - Intronic
1142289851 16:89188649-89188671 GTGTGGGCATCTGTGTGTGCCGG - Intronic
1142289855 16:89188679-89188701 GCGTGGGCATCTGTGTGTGCCGG - Intronic
1142289863 16:89188741-89188763 GTGTGGGCATCTGTGTGTGCCGG - Intronic
1142289884 16:89188881-89188903 GTGTGGGCATCTGTGTGTGCTGG - Intronic
1142289911 16:89189064-89189086 GTGTGGGCATCTGTGTGTGCCGG - Intronic
1142289922 16:89189136-89189158 GTGTGGGCATCTGTGTGTGCCGG - Intronic
1142289928 16:89189180-89189202 GTATGGGCATCTGTGTGTGCCGG - Intronic
1142289942 16:89189280-89189302 GTGTGGGCATCTGTGTGTGCCGG - Intronic
1142289948 16:89189326-89189348 GTGTGGGCATCTGTGTGTGCCGG - Intronic
1142308516 16:89299154-89299176 GCAGGGGCCCCTGTGTATCGAGG + Intronic
1142410599 16:89914223-89914245 GCATGTGTGCCTGTGTGTGTGGG + Intronic
1146006333 17:29162989-29163011 GCCTGGCCCCATCTGTGTGCAGG + Intronic
1146142206 17:30378192-30378214 AAATAGGTCCCTGTGTGTGCTGG - Intergenic
1146906575 17:36621984-36622006 GCATCTGCCTCTGTGTGTACAGG + Intergenic
1146917914 17:36689986-36690008 TCCTGGGCCCCTGTTGGTGCTGG - Intergenic
1147383437 17:40069024-40069046 GCACGTGTCCGTGTGTGTGCCGG + Intronic
1147446965 17:40480426-40480448 GCACATGCCCATGTGTGTGCAGG + Intronic
1149510559 17:57237590-57237612 GCAAGGTCCCCTATGTGTGCTGG + Intergenic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150468348 17:65414620-65414642 ACATGGGCCCCTCTGAGTGCTGG + Intergenic
1152117350 17:78396635-78396657 GCCTGGGGCCCTGTGTGGGTAGG - Intronic
1152661387 17:81543923-81543945 GCATGGGACCCTGTAGCTGCTGG - Intronic
1152934000 17:83125375-83125397 GCATCGACCTGTGTGTGTGCAGG - Intergenic
1157312248 18:46561103-46561125 GCTTGGGCCTCTGTGGGTGTGGG - Intronic
1158109149 18:53920640-53920662 GCATGGGGGCGGGTGTGTGCAGG + Intergenic
1159160042 18:64632112-64632134 GCATGGCCACCTGTGAGTGATGG - Intergenic
1160196228 18:76758023-76758045 GCCTGGGCCGCTGTCCGTGCTGG + Intergenic
1161106941 19:2448440-2448462 GAACGGGCTCCTGTGTGTCCCGG - Intronic
1161348607 19:3779872-3779894 ACATGGGCACCGGTGTGAGCGGG - Intronic
1162706037 19:12555525-12555547 GCGAGGGCCCCGGTGTCTGCGGG - Intronic
1162943732 19:14030069-14030091 GCATGTGCCCCTGGAAGTGCTGG + Intronic
1166258313 19:41620960-41620982 GCAGGGCCGGCTGTGTGTGCAGG + Intronic
1166580285 19:43892415-43892437 GCATGGGCCCATATATGTGCAGG - Intronic
1168195617 19:54771797-54771819 GTATAGGTCCCTGCGTGTGCTGG - Intronic
924991812 2:318984-319006 GTGTGTGGCCCTGTGTGTGCGGG + Intergenic
925058632 2:874139-874161 GCATGGAGCCCTGTGTGCACTGG + Intergenic
925293669 2:2764242-2764264 CCATGGGTCCCTGAGTGTGCTGG - Intergenic
925303871 2:2835691-2835713 ACATGGGCCTCTGTGGGTCCTGG + Intergenic
926633524 2:15158385-15158407 GCAGGGGCCTTTGTGTCTGCTGG - Intergenic
926739611 2:16100466-16100488 ACATGGGCCCTTGTGAGTGTGGG + Intergenic
926802003 2:16666738-16666760 GGTTGGGGCCCTGTGTGGGCTGG + Intergenic
927095995 2:19747985-19748007 GCCTGGGCCTCTGGGTGGGCTGG - Intergenic
928025747 2:27737078-27737100 ACATGGGCACCTCTGTGTGGGGG + Intergenic
929883046 2:45853961-45853983 GGATGGGCCCGTGTGTGGGAAGG - Intronic
931784613 2:65608017-65608039 TCCTGGGCCCCTGGGTCTGCTGG + Intergenic
933255667 2:80078291-80078313 GCAGGGGACCATGGGTGTGCGGG + Intronic
935585944 2:104800508-104800530 ACATGGGCCACTGGGTGTGCTGG - Intergenic
936109321 2:109652000-109652022 GCATTGGCCCCTGTCACTGCAGG - Intergenic
936278044 2:111117509-111117531 TCCGGGGCCGCTGTGTGTGCGGG + Intronic
937098469 2:119250783-119250805 GCATGCGCCCCTCTGTGCCCTGG - Intronic
938493101 2:131776209-131776231 GCATTGGCCCATCTGTGGGCTGG - Intergenic
938499377 2:131822444-131822466 GCATTGGCCCATCTGTGGGCTGG + Intergenic
938764551 2:134451540-134451562 GAAGGTGCCCCTGTGTGGGCTGG + Exonic
940910335 2:159204607-159204629 GCATGGGGCTCTGGGTGTGCTGG - Intronic
944146666 2:196514103-196514125 TCCTGGGCCCCTGAGAGTGCAGG - Intronic
946952729 2:224894956-224894978 GCAAGGGACCCTGTGTGCCCTGG - Intronic
948659306 2:239497385-239497407 GCAGGTGTCCCTGTGTGTGATGG + Intergenic
948784780 2:240346690-240346712 GTGTGGGAGCCTGTGTGTGCAGG - Intergenic
948784799 2:240346801-240346823 GTGTGGGAGCCTGTGTGTGCAGG - Intergenic
1169688798 20:8307212-8307234 GCATGGGCACGTGTGGGTGCAGG + Intronic
1170604157 20:17863491-17863513 ACATGGGCCTGTGTGTGTGGTGG - Intergenic
1170759713 20:19238945-19238967 GCATGCGCCCATGTGTGTGCTGG - Intronic
1170892719 20:20389745-20389767 GCCTGGGCCGCGGTGTGTCCTGG + Intronic
1171459833 20:25292240-25292262 GCCTGGGCCCCTGTGGGAGCGGG + Intronic
1172033508 20:31997031-31997053 GCATGGGCCCATTGGGGTGCAGG - Exonic
1173339592 20:42141452-42141474 GCATGGGCCCCAGCCTGTGAGGG - Intronic
1173715191 20:45198109-45198131 GCAGCAGCCCCTGTGGGTGCTGG - Intergenic
1173776614 20:45714061-45714083 TCCTGGGTCTCTGTGTGTGCTGG - Intergenic
1173972817 20:47165667-47165689 GCCTGGGCCCATGTGTGTCAAGG + Intronic
1174458393 20:50665698-50665720 GCATGAGCCACTGTGCCTGCCGG + Intronic
1175146118 20:56897727-56897749 GCAGGGCCCCAAGTGTGTGCTGG + Intergenic
1175445453 20:59016550-59016572 GCAGGGGCCCCTGGGTGGGGAGG + Intergenic
1175776122 20:61654813-61654835 GCGTGGCCCCCAGTCTGTGCTGG - Intronic
1175856586 20:62123658-62123680 GCCTAAGCCCGTGTGTGTGCTGG + Intronic
1175895874 20:62335381-62335403 GCAGGGGCTCCTGGGGGTGCTGG - Intronic
1176244827 20:64092523-64092545 GCATGTGTGCCTGTGTGTTCTGG + Intronic
1177739517 21:25136715-25136737 GCATGGGCCAGTTAGTGTGCAGG + Intergenic
1178307854 21:31505535-31505557 CCATGGGCTCCAGAGTGTGCTGG - Intronic
1182318953 22:29466027-29466049 GCCTGGCCTCCTGTGTGTGTGGG + Intergenic
1183416948 22:37688099-37688121 GCATGGGGCGATGTGTGTGTGGG + Intronic
1184774234 22:46615497-46615519 GCGGGTTCCCCTGTGTGTGCAGG + Intronic
1184774238 22:46615515-46615537 GCAGGTTCCCCTGTGTGTGTAGG + Intronic
1185203999 22:49526348-49526370 GTGTGTGCACCTGTGTGTGCAGG + Intronic
953223370 3:40995076-40995098 GCATGGGCTAATGTGTGTACTGG - Intergenic
953266650 3:41396157-41396179 ACATGGGCTCCTGTGAGTTCAGG - Intronic
953914290 3:46908802-46908824 GGATGTGCACGTGTGTGTGCAGG + Intergenic
954372225 3:50174905-50174927 TGAGGGGCACCTGTGTGTGCAGG + Intronic
954663070 3:52236486-52236508 GCTTGGGTCCCTGGGTGAGCAGG + Intronic
954745545 3:52785607-52785629 GTATGTGCACCTGTGTGTGGTGG + Intronic
957079224 3:75622857-75622879 GCATGTGCCCATCTGTGGGCAGG + Intergenic
962257523 3:133882701-133882723 GCCTGGGCAGCTGTGTCTGCTGG - Intronic
963237901 3:142973734-142973756 CCATGGGACTATGTGTGTGCCGG - Intronic
967089715 3:186125241-186125263 GCATGGGCCTCTGTGTGTGTAGG + Intronic
968580950 4:1394796-1394818 ACATGGGCACGTGTGTGAGCAGG - Exonic
968581091 4:1395598-1395620 ACATGGGCACGTGTGTGAGCAGG - Exonic
968581102 4:1395662-1395684 ACATGGGCACGTGTGTGAGCAGG - Exonic
968743158 4:2341383-2341405 GCATGGGCGCCTGCAGGTGCCGG - Intronic
968995105 4:3940420-3940442 TCATGGCCTCCAGTGTGTGCTGG - Intergenic
969299504 4:6289479-6289501 GCATGGGCCACTCTGACTGCAGG - Intronic
969697014 4:8740736-8740758 ACTTGGGCCCCTGGGTGCGCAGG - Intergenic
969731561 4:8960581-8960603 GCATGTGCCCATCTGTGGGCAGG - Intergenic
969791159 4:9494689-9494711 GCATGTGCCCATCTGTGGGCAGG - Intergenic
975297484 4:72751132-72751154 TCCTGGGGCTCTGTGTGTGCCGG - Intergenic
975808327 4:78136982-78137004 GCCTCAGGCCCTGTGTGTGCTGG - Intronic
978441631 4:108739795-108739817 GCAGGAGCCCCTGTGTTGGCAGG + Intergenic
982203216 4:152977813-152977835 GCAACGGACCCTGTGTGGGCAGG - Exonic
982802694 4:159723471-159723493 TCCTGGGCCCTTGAGTGTGCAGG + Intergenic
985236005 4:187875164-187875186 CCATGGGCCCCAGTGTGTGTTGG + Intergenic
987401104 5:17477814-17477836 GCATGGGCCTCAGTGTGGGAGGG - Intergenic
994373475 5:98992903-98992925 TCATAGGCCCCAGTGTGTGTTGG - Intergenic
997241753 5:132312806-132312828 CCACAGGCCCCTGTATGTGCTGG + Intronic
997293314 5:132753292-132753314 GCATTGGCCCCTGGGAGCGCTGG + Exonic
997844341 5:137272747-137272769 GCCTAGGCCCGTGTGTGTGTTGG - Intronic
1000037769 5:157461733-157461755 GGATGTGCCCCAGTGGGTGCTGG + Intronic
1002095891 5:176830698-176830720 GCACTGGCGCGTGTGTGTGCTGG + Intronic
1002536768 5:179880132-179880154 GCATGGGCCCGAGGGTGGGCAGG - Intronic
1002759757 6:192319-192341 GCGTGGGCCCTTCTGAGTGCAGG + Intergenic
1005021525 6:21423534-21423556 TCCCGGGCCCCTGAGTGTGCAGG + Intergenic
1005505872 6:26468466-26468488 CCATTGGCTCCTGTGAGTGCAGG - Exonic
1007727069 6:43923002-43923024 ACATGTGCCCCTGTGCATGCAGG + Intergenic
1008501787 6:52190763-52190785 CCATGGGCCTCTGGGTGGGCTGG - Intergenic
1009926272 6:70124944-70124966 GCATGGGGCAGTGTGGGTGCTGG - Intronic
1012178875 6:96125677-96125699 GCATGGGGCTCTGAGGGTGCAGG - Intronic
1012401883 6:98848100-98848122 GCCGGGGCTCCTGTGTGTGTCGG + Intergenic
1012750147 6:103151111-103151133 TCATGGACTCCTGTGTGTGCAGG - Intergenic
1014404619 6:121036131-121036153 GCTTGGGCCACTGAGTATGCTGG + Intergenic
1014445384 6:121521282-121521304 GCTTATGCCACTGTGTGTGCTGG + Intergenic
1016024804 6:139275819-139275841 GCATGGGCCCCTTTGAGGCCCGG - Intronic
1017587857 6:155946977-155946999 TCCTGGGCCCCTGAGAGTGCAGG - Intergenic
1018171992 6:161150922-161150944 GCATGGGTCCCTGTGTGAACAGG - Intronic
1018991060 6:168674823-168674845 GCCGGGGCCCTTGTGTTTGCTGG - Intergenic
1019415150 7:923677-923699 GGAGGGACCCCAGTGTGTGCCGG + Intronic
1019532553 7:1511026-1511048 ACAAGGGCCCCTGTGTGTAACGG - Intergenic
1020003399 7:4768488-4768510 GCATGGGACCCTGTCTCTGCTGG + Exonic
1020016328 7:4834187-4834209 CCAGAAGCCCCTGTGTGTGCCGG - Intronic
1020953910 7:14715519-14715541 GCATGTGTGCCTGTGTGTGTTGG - Intronic
1022505634 7:30907369-30907391 CCATGGCCTCCTGTGGGTGCAGG + Intergenic
1022951851 7:35346821-35346843 TGATGGGTCCCTGCGTGTGCAGG + Intergenic
1026510968 7:71027178-71027200 TCATGGGGCCCAGTGAGTGCAGG - Intergenic
1026986708 7:74559467-74559489 CCCTGGGGCTCTGTGTGTGCGGG - Intronic
1029344858 7:99971093-99971115 GCATGGGCTACGGTGTGTGCTGG + Intronic
1029346719 7:99984034-99984056 GCATGGGCTACGGTGTGTGCTGG - Intergenic
1032094682 7:128932148-128932170 GACTGGGCCCCTGAGTGTGCCGG - Intergenic
1032743125 7:134759572-134759594 GAATGTGCGCATGTGTGTGCAGG + Intronic
1033270631 7:139930017-139930039 GCATGGGGGCCTGTGTGTGGAGG - Intronic
1033500671 7:141946030-141946052 GCCTGGGCCACTGTGTGTGCTGG + Intronic
1034264569 7:149774634-149774656 GCATGTGTCACTGTGCGTGCTGG + Intergenic
1034414161 7:150956113-150956135 GCATGTGCGCCTGTATGTGTCGG - Intronic
1035278076 7:157759892-157759914 GGATGAGCCTCTGTGAGTGCTGG - Intronic
1036868993 8:12422904-12422926 TCATGGCCTCCAGTGTGTGCTGG - Intergenic
1041198998 8:55432137-55432159 GCATTGGCTTGTGTGTGTGCTGG + Intronic
1042625002 8:70748313-70748335 TCCTGGGCCCCTGCGAGTGCAGG - Intronic
1047612387 8:126533806-126533828 GCTTGGGCCCCTGTTTGTAAAGG - Intergenic
1048766814 8:137853773-137853795 GCATGTGCCTCAGTGTGTCCGGG - Intergenic
1049351133 8:142165424-142165446 GCATGGGCACCTGTGTCTGAGGG - Intergenic
1050941886 9:11471242-11471264 TCCTGGGCCCCTGAGAGTGCAGG - Intergenic
1052657526 9:31381915-31381937 TCTTGGGCCTCTGTGAGTGCTGG - Intergenic
1052996696 9:34555049-34555071 GCATGTTCCCGTGTGTGTGGTGG + Intronic
1054740945 9:68805214-68805236 GCAGGGGGCCCTGTGTGTAGAGG + Intronic
1056678385 9:88696238-88696260 TCATGGACCCCTGTGTGTGTGGG + Intergenic
1057024789 9:91726531-91726553 GCATGGAGACCTGTTTGTGCTGG + Exonic
1057052531 9:91936409-91936431 TCATCTGCCCCTGTGTGAGCTGG + Intronic
1059245402 9:112845472-112845494 GAAGTGGCCCCTGTGTGAGCAGG - Intronic
1059649770 9:116305082-116305104 GCCTGTGCCTCTGTGTGTGGTGG - Intronic
1060269809 9:122132438-122132460 GCAGGGTCACCTGTGTGTGCTGG - Intergenic
1060756708 9:126219220-126219242 GACCGGGCCCCTGTGTGTGCAGG - Intergenic
1061670531 9:132185801-132185823 GACTGAGCCCCTGTGTGTGCAGG + Intronic
1062328445 9:136023958-136023980 GCATGTGCACGTGTGTGTGGGGG - Intronic
1062444181 9:136586822-136586844 GTGTGTGCCTCTGTGTGTGCAGG + Intergenic
1062631307 9:137464312-137464334 GCATGGGCTCCTGAGGGTGGGGG + Intronic
1195203555 X:102572771-102572793 GCCTGGGTTCCTTTGTGTGCAGG + Intergenic
1197980922 X:132217674-132217696 CCCTGGGCCCCTTTGTGTGAAGG - Exonic
1198136946 X:133762727-133762749 GTATGGACCCCTCTGTGGGCAGG - Intronic
1198401699 X:136274916-136274938 GAATAGGCCCCTGTAAGTGCTGG - Intergenic
1201189624 Y:11435912-11435934 GGATGGGGCCCTGTGTGTGGAGG + Intergenic