ID: 1095564233

View in Genome Browser
Species Human (GRCh38)
Location 12:43602229-43602251
Sequence CCTAGGGACCATTACTACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095564228_1095564233 20 Left 1095564228 12:43602186-43602208 CCACAGAACATGAAGGGTGTGTT No data
Right 1095564233 12:43602229-43602251 CCTAGGGACCATTACTACAGAGG No data
1095564227_1095564233 21 Left 1095564227 12:43602185-43602207 CCCACAGAACATGAAGGGTGTGT No data
Right 1095564233 12:43602229-43602251 CCTAGGGACCATTACTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095564233 Original CRISPR CCTAGGGACCATTACTACAG AGG Intergenic
No off target data available for this crispr