ID: 1095565979

View in Genome Browser
Species Human (GRCh38)
Location 12:43623463-43623485
Sequence CAAAAGACAAAATTGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095565979_1095565983 24 Left 1095565979 12:43623463-43623485 CCATTTGTCAATTTTGTCTTTTG No data
Right 1095565983 12:43623510-43623532 ACATGAAGTCCAACTTACAAGGG No data
1095565979_1095565980 -7 Left 1095565979 12:43623463-43623485 CCATTTGTCAATTTTGTCTTTTG No data
Right 1095565980 12:43623479-43623501 TCTTTTGTTGCCATTGCTTTTGG No data
1095565979_1095565982 23 Left 1095565979 12:43623463-43623485 CCATTTGTCAATTTTGTCTTTTG No data
Right 1095565982 12:43623509-43623531 GACATGAAGTCCAACTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095565979 Original CRISPR CAAAAGACAAAATTGACAAA TGG (reversed) Intergenic