ID: 1095565980

View in Genome Browser
Species Human (GRCh38)
Location 12:43623479-43623501
Sequence TCTTTTGTTGCCATTGCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095565979_1095565980 -7 Left 1095565979 12:43623463-43623485 CCATTTGTCAATTTTGTCTTTTG No data
Right 1095565980 12:43623479-43623501 TCTTTTGTTGCCATTGCTTTTGG No data
1095565978_1095565980 -6 Left 1095565978 12:43623462-43623484 CCCATTTGTCAATTTTGTCTTTT No data
Right 1095565980 12:43623479-43623501 TCTTTTGTTGCCATTGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095565980 Original CRISPR TCTTTTGTTGCCATTGCTTT TGG Intergenic