ID: 1095565981

View in Genome Browser
Species Human (GRCh38)
Location 12:43623489-43623511
Sequence GTCTAAAACACCAAAAGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095565981_1095565986 19 Left 1095565981 12:43623489-43623511 CCATTGCTTTTGGTGTTTTAGAC No data
Right 1095565986 12:43623531-43623553 GGATATGAAGGACCTCTTCAAGG No data
1095565981_1095565982 -3 Left 1095565981 12:43623489-43623511 CCATTGCTTTTGGTGTTTTAGAC No data
Right 1095565982 12:43623509-43623531 GACATGAAGTCCAACTTACAAGG No data
1095565981_1095565983 -2 Left 1095565981 12:43623489-43623511 CCATTGCTTTTGGTGTTTTAGAC No data
Right 1095565983 12:43623510-43623532 ACATGAAGTCCAACTTACAAGGG No data
1095565981_1095565985 7 Left 1095565981 12:43623489-43623511 CCATTGCTTTTGGTGTTTTAGAC No data
Right 1095565985 12:43623519-43623541 CCAACTTACAAGGGATATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095565981 Original CRISPR GTCTAAAACACCAAAAGCAA TGG (reversed) Intergenic