ID: 1095565982

View in Genome Browser
Species Human (GRCh38)
Location 12:43623509-43623531
Sequence GACATGAAGTCCAACTTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095565978_1095565982 24 Left 1095565978 12:43623462-43623484 CCCATTTGTCAATTTTGTCTTTT 0: 2336
1: 12309
2: 7521
3: 4978
4: 6484
Right 1095565982 12:43623509-43623531 GACATGAAGTCCAACTTACAAGG No data
1095565981_1095565982 -3 Left 1095565981 12:43623489-43623511 CCATTGCTTTTGGTGTTTTAGAC 0: 9694
1: 7889
2: 2856
3: 966
4: 781
Right 1095565982 12:43623509-43623531 GACATGAAGTCCAACTTACAAGG No data
1095565979_1095565982 23 Left 1095565979 12:43623463-43623485 CCATTTGTCAATTTTGTCTTTTG 0: 2333
1: 12359
2: 7428
3: 4618
4: 5453
Right 1095565982 12:43623509-43623531 GACATGAAGTCCAACTTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095565982 Original CRISPR GACATGAAGTCCAACTTACA AGG Intergenic
No off target data available for this crispr