ID: 1095565983

View in Genome Browser
Species Human (GRCh38)
Location 12:43623510-43623532
Sequence ACATGAAGTCCAACTTACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095565979_1095565983 24 Left 1095565979 12:43623463-43623485 CCATTTGTCAATTTTGTCTTTTG No data
Right 1095565983 12:43623510-43623532 ACATGAAGTCCAACTTACAAGGG No data
1095565978_1095565983 25 Left 1095565978 12:43623462-43623484 CCCATTTGTCAATTTTGTCTTTT No data
Right 1095565983 12:43623510-43623532 ACATGAAGTCCAACTTACAAGGG No data
1095565981_1095565983 -2 Left 1095565981 12:43623489-43623511 CCATTGCTTTTGGTGTTTTAGAC No data
Right 1095565983 12:43623510-43623532 ACATGAAGTCCAACTTACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095565983 Original CRISPR ACATGAAGTCCAACTTACAA GGG Intergenic