ID: 1095565986

View in Genome Browser
Species Human (GRCh38)
Location 12:43623531-43623553
Sequence GGATATGAAGGACCTCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095565981_1095565986 19 Left 1095565981 12:43623489-43623511 CCATTGCTTTTGGTGTTTTAGAC No data
Right 1095565986 12:43623531-43623553 GGATATGAAGGACCTCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095565986 Original CRISPR GGATATGAAGGACCTCTTCA AGG Intergenic